Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Cobalamin in Desulfovibrionales

Properties
Regulator family: RF00174
Regulation mode:
Biological process: Cobalamin biosynthesis
Effector: Adenosylcobalamin
Regulog: Cobalamin - Desulfovibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Desulfovibrio vulgaris Hildenborough
DVU0650 cbiK -318 93 GCCTATGCCGCACGAGTCAGGTGCCCTGAGCGGCTTGATAGGGAATCCCGTGTGAATCGGGAGCGGACCCGCCGCCGTAAGCCCATAAAAGACCTTCTCCCCCGTGTGCCACTGGACGACCGTCCGGGAAGGCCGGAGCAGGTCGGGTGAGCCGGAAGACCTGCCTGACACGTCCGATGCCAT
DVU2947 nrdD -348 56.3 TTCCCCGTCTGCTATTCGTGCACCGTCGTTCTTCTCCGGTTTCGGGAATCCGGTGCGAGTCCGGAGCGGTCCCGCCGCTGTCATCCCTGCGCCTCGGGCGCCACGCCACAGCCATGAAGCCACTGCCCCCTGCGGGCGGGAAGGCGGTTGTGAGTGGGGAGAGCCAGAATACCGGGCCGGAGCAGTCTCGATCCC
DVU3371 metE -322 59 TATCAATATGGAGTGCTTCGGCGCTCCGGTGGGCAGGAAACGGAAACCGGTGCGAATCCGGTACAGGCGCGCTGCCGTGATCGGGCTGCAAGGGCTGCGTCCACTGGTGCCAAGGCACCGGGAAGGGCCGCCCTGTCGAGTGGGCTTCAATTTCGCATGGTGCGACCGCTCGGCATCATCTCTTCGCCCGTCAGTCGGAAGACGTCCCCCACCCTTGTTGAGGCCG
Desulfovibrio vulgaris str. Miyazaki F
DvMF_1496 cbiK -382 95 CTATCCATGAACCTTCAGGTGTCCATCGGACTTGATAGGGAATCCCGTGCAAATCGGGAGCGGACCCGCCGCCGTAAGCCCGCGAGAACGCCTGCTCCCCAGCGCGCCACTGGATCATGATCCGGGAAGGCCGGAGCAGGTCGGGCAAGCCGGAAGACCTGCCTGACGCGTCATCGGCCATGC
DvMF_1473 nrdD -372 26.9 CAAAGGGAATCCGGTGCGACACCGGAGCGGTCCCGCCGCTGTGATCCCCGCGCGCATGGCGCGCAACGTCCGCCCCGGCACGGGCATGAAGCTTGCGCTTCGTCCCGCCGCCGCAGCGCCACTGGCACCGGGTTCCGCCCGCGCCGGGAAGGCGGGCCGGACGGGGGAAAGCCAGAAAACCT
Desulfovibrio desulfuricans G20
Dde_3103 cbiK -103 99.2 TAACCCGAATCGATTCAGGTGCCCTGCGGGGCTTGATAGGGAATCCCGTTAAAGTCGGGAGCGGACCCGCCGCCGTAAGTCCACGATACGCCGCATCCACACCGTGCCACTGGGAAAAATTCCCGGGAAGGCCGGATGCCGCGGGACAAGCCGGAAGACCTGCCTGAGTGTACAGGATGACTTT
Dde_3016 nrdD -265 15.7 AACCGGTGTAATTCCGGTACGGTCCGGCCGCTGTGTCCCTGCAGGGGCTACAGTCAG
Dde_2328 metE -297 79.2 TTGAATATTGATGAATCTTGATATTGTGATGTTTTGTGTATGGAAACGGAATGCGGTGCAAATCCGCAGCGGACGCGCCACTGTAACCGGCAAGCCCGGCCGACGTCACTGCCGCAGAGGCGGGAAGACCAGGCCATATGGGGCCGGAAGCCAGGAGACGACCATGCACAAGAGCACGGCA
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Ddes_0796 btuC -548 77.4 AAAGTATGCGCGGCAATGGTAGCCGGAACACCGGCTTGAAAAGGGAATCCCGTGCAATGCGGGAGCGGACCCGCCGCCGTAAGGTTCATGAACCTCGCACCATGCAGCGCCACTGGAAACGGGAAGGCCGGGGCGGGGGAACCAAGCCGGAAGACCTGCCTTGCCCTGCGGCCCGCGCAT
Ddes_2334 cbiK2 -255 55.6 TGACATTTACCGCGCCCTGTTGTCCTCTGTCGTTTTGGCGGGGAATTTCGTGCAAATCGAAAACAGTCGCGCTGCGGTAAGAGGGGACAAAGCTTCTTCATGCTGTTCTGAAGAGCGGCATGCGACAGCCAGTCGCATATGCGGTGAAGGCGAAGCCAAGGCGCGGGCCATATGGCCCCACAGCCCTCAAGTCCGAACATCCGCCGGGGCCGGTGCCCCTTGCGA
Ddes_1071 null -138 102.7 ATTTTCTAGACATTGAAAGTGCCCCACCGGGCTTAATCGGGAATCCCGTGAAAAGCGGGAGCGGACCCGCCGCCGTAAGCCGGGCAACAAACTGTCTTTCACCATGCGCCACTGGGTTCAGCCCGGGAAGGCCGAAAGATGGCCGGCAAGCCGGAAGACCTGCTTTCAACTTACCTTCAAAGGG
Desulfovibrio piger ATCC 29098
DESPIG_00414 btuC -106 83.1 TAGAGTAGCGCGTCCATGGTCGCCGGAACCTGCCGGCGTCAAAAGGGAATCCCGTGAGAATCGGGAGCGGACCCGCCGCCGTAAGGCCCGCAGACCAGCTTCCTTCATGTGCCACTGGCAACGGGAAGGCCGGAAGCCGGGGGCCGAGCCGGAATACCTGCCGTGGACCGTGGCCGTTGGCC
DESPIG_01756 cbiK2 -220 47.8 CCCAAACCGTTTCTGATGGCGCAGCCATGCGGGGAATTCCGTGTGAATCGGAAACAGTCGCGCTGCGGTAAGAGGGTACGGAGCTTCTTTGGCGACACGCCACGACAGCCAGCCGTCACGGTGAAGGCGAAGCAAAGGCCCGGAGGCATGCCTCCCCATTCCCTCAAGTCCGAATACCCGCCCCATCCCCAACCTTTCAACG
DESPIG_00246 nrdD -330 71.6 CATCTTGAGCGGGCAGAAGCGCTGCTACGAGCTTCATCGGGAATCCCGTGAGATCCGGGAGCGGACCCGCCGCCGTAAGTCGCAGAACCTGCTCCCCCCGTGTGCCACTGGCAGCCGCCGGGAAGGCCGAGAGCAGGGTGACGAGCCGGAAGACCTGCTTCTGCCGCTTGTCCATGGGG
Desulfovibrio salexigens DSM 2638
Desal_2307 cbiK -306 76.2 ATATTTAGCCTTTGCCTGAGGCGCTCTCACGAGCTTAATAGGGAATCCCGTTAAAGTCGGGAACGGACCCGCCGCCGTGAGTCCTTAACGGTTTTACCCCGTGTGGCCGGAATAAATCCGGTCCTGTGTGCCACTGAATAAATTTTCGGGAAGGCCGGGTGAAATGGGACGAGTCGGAAGACCTGCCCGGGTGCAAATCACGATC
Desal_3514 nrdD -420 40.7 ACTTCAGGAATCCGTTTCTGCTTTCTGAGCACATTGAAACTGATTAGTCGGGAACCCGGTTTGAATCCGGGGCGGTACTGCCGCTGTCAGGGAAACATTCTGTGTTACCCCGAGCCAGCACCCCGGCCTGAAGTATGCCTGCCCGG
Desal_0813 metE -265 58.6 TATATTGAATTTGATTTGTATGCGCCCGCAGGAAACGGAAGACGGTGAGAATCCGTCGCAGGCGCGCTGCTGTAACCGGGTAAATCAAGAAGGATATGGTGTCGGCCCACTGTTGGAAAAACGGGAAGGAGCGGCACTGTGCGTCGAACAGGCCCGGAAGCCAGAAGACGTCCTGCAGGAGCAAGTGTCGGACCTC
Desal_0826 nrdA -393 38.6 TCGTTGTGTTTTCACTTCAGGACCATTTAAATTAATCAGGGAACCCGTTTAAAGTGCGGGGCGGTTCTGCCGCTGTGATTCCTCCATTTCATGGATCAGGAAAAGCCAGCAACCCTGCCTGAAGCATATCTGCACAA
Desulfovibrio magneticus RS-1
DMR_15530 cbiK -291 83.9 CTCCCCGGAAATCGACCTGGGCGCCCTCACGGGCTTAATAGGGAATCCCGTTCAAATCGGGAGCGGTCCCGCCGCCGTCAGTTCCACGCAAAGGTCGGCCTCCACGCGCGCCACTGGGAAGCACTTCTCGGGAAGGCCGGGGCCGATGGAACAAGCCGGAAGACCTGCCCGGGTTCTGGCACATCCC
DMR_44320 nrdD -388 79.5 AAGAGGGAATCCGGTGCAAGTCCGGAACTGCCCCGCAGCGGTAAGCGAAAACGAACCCCGCAACCAGGCACTGGGCGACATCCGCCCGGGAAGCCGCGGGAACTAGGAAACCGGCCCACACCGGGCCGACGCGTTCGCAAGTCCGAACACCTGC
Desulfomicrobium baculatum DSM 4028
Dbac_1710 cbiK -266 92.2 GCGTCTTTTCCACTTCGGATACCTTAGGGTGTAAAAGGGAATCCCGTGCAAATCGGGAGCGGACCCGCCGCCGTAAGTTTCAAAAAAAGCCATGCTCCACGCTGTCCACTGGGATCGGTTCCGGGAAGGACGAGAATGGTGAAACGAGCCGGAAGACCTGTCCGAGGTCCAGTCACAAGTCT
Dbac_3396 nrdG -236 55.7 GTCCTAATACTTAACCTGTTCTGCGAAACTACTTCAGGAGCAAGGGAACCCGGTGCGAGTCCGGGGCGGTCCCGCCACTGTAACCCCGATTTTGCGTGCCCGAGCCGATCCCCTTTGGGAGAAGCCGCATGCGGGGCAAGCCAGAAAACCCGCCTGAAGCAATTCTCTTAACCC
Desulfohalobium retbaense DSM 5692
Dret_0028 btuB -302 108.9 GTTGTATCCTGCCCCCAGGTCGCCTTACGTATCGCGTGAGGGTGAAATGGGAAGTCCGGTGAAAATCCGGCGCTGGCCCGCAACCGTGAGAGGGGACGGCGGACACAGATAAGCCACTGCCTGCAGCAGGTGGGAAGGCGTGTCCGGCCGGCAGATCCTCAAGCCGGGAGACCAGCCTGAGGGGCGTAACCAATCGG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD