Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Cobalamin in Bacillales

Properties
Regulator family: RF00174
Regulation mode:
Biological process: Cobalamin biosynthesis
Effector: Adenosylcobalamin
Regulog: Cobalamin - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus subtilis subsp. subtilis str. 168
BSU33180 btuF -245 78.4 CGGATACGAATGTCAAATAGGTGCCGGTCCGTGAACAACAGCCGGCTTAAAAGGGAAACCGGTAAAAGCCGGTGCGGTCCCGCCACTGTAATTGGCCAAGCGCCAAGAGCCAGGATACCTGCCTGTTTGATCAGCACGAAT
Bacillus pumilus SAFR-032
BPUM_1215 metE -345 113.9 AATTCATAGTTTGAGAGTCGGTAATTCGATCACACGTCGAATTTTAAATGGGAAGACCGGTGAAAATCCGGCGCGGTCCCGCCACTGTGAGTGAGGAGAGCTTTTCTAATGAATCCACTGTCATCAGGACGGGAAGGATGAAAAGCTTGCAGATTCACCAGCCAGGATACCAGCCGCTCTATCACATCAAACC
Bacillus licheniformis DSM 13
BLi01422 metE -338 114 ATTTCATCGCCGGGAACATGGTAATCTAACGAGGTTAGATTTTAAAAGGGAAGTTTGGTGAAAATCCAACGCGGTCCCGCCACTGTGAATGAGGAGGTTATTTCATAAAACCCACTGTTTCTATATGGGAAGGGGGAAATAACCGTCGATTCATGAGCCAGGAGACCTGCCTGTTCTGACGCACCATAA
Anoxybacillus flavithermus WK1
Aflv_1041 btuF -396 131.9 TATGTCCGTTGCAAAAAGGTGTCGAACGGGCAACCTAGTAGACTTAATAGGGAATCTGGTGCAAGGCCAGAACTGTCCCCGCAACTGTAAATGCTGACGAAATGAAACGTGCCACTGTACAATTTGTACGGGAAGGCTTCAAAGTAGGATGACGCATAAGTCAGTAGACCTGCCTTTTTGCTTCGTCATTCGCG
Aflv_2185 cbiW -317 111.8 ATATACGATCAGCAAGTACGGTGCATACGTCTGTGTGCTTAAAAGGGAAGAACGGTGCAAAGCCGTCGCGGTACCCGCCACTGTGATGGGGAGTTTTGTTGCAATATGCCACTGATTTTTGGGAAGGCGCAACGAAATGATGAACCTAAGCCAGGAGACCTGCCTGCTTGCGATACGTCGGC
Aflv_0393 nrdA -316 121.4 ATTGAAACCAACAAGTGAAGGTGTCCAAACGGACTTAATAGGGAATCTGGTGCGAATCCAGAACTGTCCCCGCAACTGTGTGCGCAGACGAAATGGAAATAACACCACTGTATATGTCAGCTATTTATGGCGCATATATGGGAAGGAATCCAAAGTAGGAAGAAGCGCAAGTCAGGAGACCTGCCTTCCTTGTATCGTTTCAT
Geobacillus kaustophilus HTA426
GK1810 cbiW -378 117.9 TAGGCGAGAAACAAAACAAGGTGCCTAGCCCGCTTAGGGCTTGGGTGAAAAGGGAAGCTCGGTGAAAATCCGGCACGGTGCCCGCCACTGTGATGGGGAGCTTTGCGGCAGCAAGTCACTGAAGGATGCTTCGGGAAGACGCCGCCAAGCGATGATCCTAAGTCAGGAGACCTGCCTTGTTTGGATCGGACGGA
GK2266 btuF -341 122.2 CTAAATCAACTCGCAGCAAGGCGCCGAAAAGGCTTAATAGGGAATCCGGTGGGAATCCGGAGCTGTCCCCGCAACTGTCAATGCGGACGAAATGAAATCGCCACTGTACGGACGGATGGCTTGCGCTGTTTTCCGTACGGGAAGGCTTCAGAGTAGGATGAAGCATGAGCCAGTAGACCTGCCTTGCTTGCCGCAGTTTCC
GK0911 nrdA -249 123.9 TCGTTGCGCCAAGCAATGGTGTCCATCAGGACTTAATAGGGAATCCGGTGTGAATCCGGAACTGCCCCCGCAACTGTATGTGCGGACGAAATGGGATGGCCACTGGCGGCAAGAGCCATTCGGCGCGCCGCTGGGAAGGCCCCAAAGTAGGACGATGCACGAGTCAGGAGACCTGCCTTGCTTGGAACGTTTCATGT
Bacillus cereus ATCC 14579
BC4003 metE -315 114.9 CTTTCAAAAGGAAAATAGGTACACGAAAGTTTTGTTTCGTGTTTAAAAGGGAAGCTTGGTGAAACTCCAACACGGTCCCGCCACTGTAAATGCTGAGATTTCTTTTTGGTGCCACTGTGAAAACGGGAAGGTAAAAGAAATTATATGAAGCATAAGTCAGGAGACCTGCCTGTTTTAACAACACTGATAG
Bacillus halodurans C-125
BH0284 cobT -253 89.8 CTTTAATAGGCTTCTTAGGTGCCTCATTTGTAGGAGAATAGGGAAGTTCTGAAACGACGCGGAGCCCGCCACTGTAGTCGAGGAGCTGCTACAATACCACTGGGAAACTGGGAAGGTGTAGCATGCGATGAATCGGAGCCAGGAGACCTGCCTAAGAAGATGCGCTGTCATT
BH1585 btuF -407 118.7 CGTATATCGCGCTGAAGGGTCGTTCAATGTTTGAGCGTGAAAAGGGAAGTCGGTGAAAATCCGACACGGTCCCGCCACTGTAAATGGGAGAGGCTTGCAAGATCCACTGTCTAGCGACGGGAAGGGGGCAAGTACTCGATGAACATAAGTCAGGAGACCTGCCTTTCAGTTTGAGTGTGTAGC
BH0438 metE -340 123.6 ATTTCATCGTTTGGGAACAGGTACGTTAAGTCACATGATAGACTTAATGTTTAAAAGGGAATCCGGTGCAAATCCGGAGCGGTCCCGCCACTGTCATAGCTGAGTTGTAACGATATTGTCACTGACCGTTCATTGGTTGGGAAGACTGTTGCAATGTTGACGCTAGAGCCAGGAGACCTGCCTGTTCTAACAGCACTGCT
BH0501 nrdA -351 119.7 GTGTTTGTGGACGGTAAGGTGCCCGAAGCGGCTTAAAAGGGAATCTGGTGCAAATCCGGAGCTGTCCCCGCAACTGTGAGTGCTACGAACGGAACGATTTGCCACTGTACATCCTCTACTTCTTGAGAAATGTATGGGAAGGCTTCTAAGTAGGTAAAGCACGAGTCAGGAGACCTGCCTTACTTCCACAAGTTTCGCA
BH0798 achX -384 114.3 AGCACGCTCAAGCATTAGGTGGTTCAAACAATCGGTTGAATCTGAAAAGGGAAGCTGGTGAAAGTCCAGCACGGTCGCGCCACTGTAATAAGGAGCTACATGTGAGGAAACCACTGTCCAAAGGATGGGAAGGTACACATGGAGTGTTGATCTTAAGTCAGGAGACCTGCCTAATGTATGCACTTGCACCT
Bacillus clausii KSM-K16
ABC1449 metE -302 60.7 TTTTATAGATGCAACCAGGTGCGGCTATTGCCGCTTAAAAGGGGAAGCTGGTGAAAATCCAGGACGGTCCCGCCACTGTGACACGAGATGCAACATTTATTCGTGAAGTCAGATTGCCTGCCTGTTTGTACTGCTTGACTCT
Paenibacillus sp. JDR-2
Pjdr2_3355 btuF -357 95.1 ACGAATAAATCATGGAACAGGTGCTGCAAGAGCCGTAAGGCTGTTGCAAGCTTAATAGGGAAGTCCGGTTAAAATCCGGCACGGACCCGCCACTGTAAGAAGCGGTCTAAGTTTATTTAGACCCGTGTGCCAGCTTAAGTCACTGAATGCAAGATTCGGGAAGACGCTGGCGCTACTGCTTCAAGTCAGGAGACCTGCCTGTTCGCATAACGCTGTA
Pjdr2_2684 Pjdr2_2684 -365 102.5 ATACGAGATAAGTATCAGGTGCCAATGATACCTTCCGCCGGTTAGGGCGATGGTATTGGATTGGTTAAAAGGGAAGTTGGGTGAGAATCCCACGCGGTCCCGCCGCTGTAAGAGACGAGTCTATGCGCATATCCACTGGGCAACCGGGAAGGGTGCATAGGCATTGACGCTCGAGCCAGAATACCTGCCTGATTCTTTTTTACACCACA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD