Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Cobalamin in Thermotogales

Properties
Regulator family: RF00174
Regulation mode:
Biological process: Cobalamin biosynthesis
Effector: Adenosylcobalamin
Regulog: Cobalamin - Thermotogales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Thermotoga maritima MSB8
TM0080 btuF -158 95 GTATGATTTTCAAATAGAAGCCTCCCTCACCGTGCGGTACCCTTCGGGGTTCAAAGGGGAAGCCGGTGAAAATCCGGCGCGGGGCCGCCACCGTGACCGGGGACGAAACCCGCAGAACGCCACTGGGGCGATCACCCTGGGAAGGCGCGGGGAGTAGGATGATCCGGAAGCCGGGAAACCCGCCCGCGGTGAAGGGGAACCA
Thermotoga sp. RQ2
TRQ2_0867 btuF -253 96.9 TATGATCTTCAAATAGAGGCCTCCCTCACCGTGCGGTACCCTTCGGGGTTCAAAGGGGAAGCCGGTGAGAATCCGGCGCGGGGCCGCCACCGTGACCGGGGACGAAACCCGCAGAACGCCACTGGGGTGATCACCCTGGGAAGGCGCGGGGAGTAGGATGATCCGGAAGCCGGGAAACCCGCCCACGGTGAAGGGAAACCACC
Thermotoga neapolitana DSM 4359
CTN_0612 btuF -219 105.3 AACCTCCCTCACCGTGAGGTACCCTTTTGGGTTCAAAGGGGAAGCCGGTGAGAATCCGGCGCGGGGCCGCCACCGTGACCGGGGACGAACCCCGCACGATGCCACTGGGGCTTTTGCCCTGGGAAGGCGCGGGGAGTAGGATGATCCGGAAGCCGGGAAACCCGCCCGCGGTGAAGGGAACCACCT
Thermotoga petrophila RKU-1
Tpet_0844 btuF -230 93 AGCCTCCCTCACCGTGCGGTACCCTTCGGGGTTCAAAGGGGAAGCCGGTGGAAATCCGGCGCGGGGCCGCCACCGTGACCGGGGACGAAACCCGCAGAACGCCACTGGGGCGATCACCCTGGGAAGGTGCGGGGAGTAGGATGATCCGGAAGCCGGGAAACCCGCCCGCGGTGAAGGGAAACCACC
Thermotoga naphthophila RKU-10
Tnap_0710 btuF -238 93 GAAGCCTCCCTCACCGTGCGGTACCCTTCGGGGTTCAAAGGGGAAGCCGGTGGAAATCCGGCGCGGGGCCGCCACCGTGACCGGGGACGAAACCCGCAGAACGCCACTGGGGCGATCACCCTGGGAAGGTGCGGGGAGTAGGATGATCCGGAAGCCGGGAAACCCGCCCGCGGTGAAGGGAAACCA
Thermotoga lettingae TMO
Tlet_1275 btuF -234 113.2 TGAATAAGAAGCGTCGGAGGGTACCAAGAAGGTTTAATAGGGAAGCCGGTGAAAATCCGGCACGGGGACGCCACCGTGACCGGGGACGAAACCCACAGATACCACTGGCATTGCTGGGAAGGTGTGGGAAGTAGGATGATCCGGAAGTCGGGAGACCTGCCCTTCGATTAAGCTCGCCA
Tlet_1236 cobT -582 105.3 TGATAAAATAAATATAAAGAATATTTTACTGCTCAATGTCAAGGGAACACCGGTGAGATTCCGGGGCTGCCCAGCAACCGTGAGCGGGGACGAAAGCCACATCAAAAGCCACTGGCTCATGCCGGGAAGGCGTGGTAAGTAGGAGGATCCGCAAGCCGGGAGACCTGCTTTGAGTAGAGTTTTTTCCCG
Tlet_1461 sucC -167 133.3 TATGATTTTCCACCTGAGGTTCCATTTATGGATTAAAAGGGAATCCGGTGAAAATCCGGAGCTGCCCAGCAACCGTAACTGGGGACGAAATCCGCAGAAAGGCCACTGGTACAATCCGGGAAGGCGCGGAGAGTAGGATGATCCAGAAGCCGGGAGACCTGCCTTAGGTGTATTCTTCCCCGA
Thermosipho africanus TCF52B
THA_1065 cobT -244 131.2 ATAATGTTAACACCTTGGGTACCAAAGCGGTTTAAAAGGGAACGCCGGTGAAAGGCCGGGGCTGCCCAGCAACCGTAACCGGGGACGAAATCCACAGAATGCCACTGGGAGTATTTCCTGGGAAGGCGTGGAGAGTAGGTTGATCCGGGAGCCGGGAGACCTGCCTAAGGTGTAACAATTCCACA
THA_254 btuF -241 96.6 CTATTTGCAGCAACTTAATATTTCCCTTTCAAATAAGGGAAGCCGGTGAAAGTCCGGCACGGGGACGCCACCGTAACCGGGGACGAAATCCACAAAATGCCACTGGGATATTTCCTGGGAAGGCGTGGAGAGTAGGATGATCCGGAAGTCGGGATACCTTATTTGAAAGGAAAGCAATCCAC
THA_1046 cobT -602 112 AATATAGAAAACCATCATAGGTTAAGGGAACACCGGTGAAAGGCCGGGGCTGCCCAGCAACCGTAACCGGGGACGAAATCCACAGGATGCCACTGGGAGTATTTCCTGGGAAGGCGTGGAGAGTAGGTTGATCCGGGAGCCGGGAGACCTGCCTATGATGAAAGTCACTTC
Thermosipho melanesiensis BI429
Tmel_0038 btuF -242 99.4 TGATATAATTATGTTAGAATAATTTCCTTCTAAAAAAGGGAAGCCGGTGAAAATCCGGCGCGGGGACGCCACCGTAACCGGGGACAAAATCCACTTAAAGCCACTGGGACTATCCTGGGAAGGCGTGGAGAGTAGGTTGATCCGGAAGCCGGGATACCTTTTTTAGAAGGAAAGTTTACCAC
Tmel_0695 cobT -233 134.7 AATAATAAAACATCTAGGGTACCAAGCGGTTTAAAAGGGAACTCCGGTGAAAGTCCGGGGCTGCCCAGCAACCGTAACCGGGGACGAAATCCACAAAATGCCACTGGGAATTTTTCCTGGGAAGGCGTGGAGAGTAGGTTGATCCGGGAGCCGGGAGACCTGCCTTAGATGTATGGACTCCACA
Tmel_0854 cobT -219 113.9 TATAAATTGTTACTATAGGTTAAGGGAACTCCGGTGAAAATCCGGGGCTGCCCAGCAACCGTAACCGGGGACGAAATCCACAAAATGTCACTGGGAATTTTTCCTGGGAAGGCGTGGAGAGTAGGTTGATCCGGGAGCCGGGAGACCTGCCTATAGTAAGGTTATTTCCCG
Tmel_1870 sucC -242 132.1 ATAACCAATGGAATAAAGGTGCCTTAAAGGCTTAATAGGGAAGCTGGTGAAAATCCAGCGCGGCCCCGCCACCGTAACTGGGGACGAAAGTCGCAAAGTGCCACTGGGATTTCCTGGGAAGGTGCGACGAGTAGGTTGATCCAGAAGCCGGGAGACCTGCCTTTGTTCCAAAGTGTTTCTC
Fervidobacterium nodosum Rt17-B1
Fnod_0257 btuF -231 96.8 AATAAACCTCCCTTTGCATGTTGAAAGGGAAGCCCGGTGAAAATCCGGCGCGGGGCCGCCACCGTGAGTGGGGACGAAATTCACAATATACCACTGGCCTAATTTTGGCTGGGAAGGTGTGAAGAGTAGGATGATCCACGAGTCGGGAGACCTAACATGCAAAGGAAGGGAGCC
Fnod_1365 cobT -265 99.6 AAAAACAAACCGAATAAGTTTGACTACCTAGTGTGCCGGGAACACCGGTGGAAATCCGGGGCTGCCCAGCAACCGTGAGTGGGGACGAAACCTACATTGATGCCACTGGCTCATTTCGATGAGCTGGGAAGGCGTAGGGAGTAGAATGAACCACGAGCCGGGAGACCGACATTAGGTAGATTTCTTTCCTG
Fnod_1378 sucC -261 122.2 ATATTCCAAACTGCGAAGGTGCCGAAAGGCTTAATAGGGAACTCCGGTGAGAATCCGGGACGGTCGGGCCACCGTGAGTGGGGACGAAATGCTCAACTGGCCACTGGCTTTTTTAGCTGGGAAGGCGAGCAGAGTAGGATGAGCCACAAGTCGGGAGACCTGCCTTCGTAGGATGGCATTCCCA
Petrotoga mobilis SJ95
Pmob_0038 btuF -232 101.5 TAATATTTACTGCATTATTTTAAGGGAAAACGGTGAAAATCCGTTACGGTCGCGCCACCGTAATCGGGGACGAAACTTACAAAAAGCCACTGGAGAGATCCGGGAAGGCGTAAGGAGTAGAGTGATCCGAAAGTCGGGAGACCTGAATAATGCTGTTTTTTCTATCT
Thermotogales bacterium TBF 19.5.1
Kole_1602 btuF -268 100.3 TGATCCGATTTAAAGATCTGGACAGACACTTCTCAAGGTAAACGCATAACCGGACAACAACGTCGGGATCAGGGAAACCGGTGAAAATCCGGTGCGGGCCCGCCACTGTGAGTGGGGACAAAATCCGCAATTATGCCACTGGCGAAAGCTGGGAAGGCGCGGAGAGTAGGATGATCCACGAGCCAGGAGACCTCCCCGACGTTTAAGGTTCGCC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD