Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Cobalamin in Shewanellaceae

Properties
Regulator family: RF00174
Regulation mode:
Biological process: Cobalamin biosynthesis
Effector: Adenosylcobalamin
Regulog: Cobalamin - Shewanellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Shewanella oneidensis MR-1
SO_0815 btuB -338 74.4 TTGAGTCAACCTTCTGTGGTGCTTGCGATGATAGCGTCGCGAGATAATCGGGAAGCCAGTGAAATTCTGGCACTGCCCCCGCAACGGTAAAAGGTGAGAGACGGCCGCATTCGATAGGTGTTCACGATGAACCCGTAAATCGCAGTGTGCAAAGGTCAGTTTCGCGTTTATCTCTAGTGAGATGGATTATAGCCTAAGTCCGGAGACCGGCCCTAAAGGTGTTTTTGAGATT
SO_1033 btuD -475 57.8 TAAATGTCGCAGAAATAGGTGTTGGGAATTTCGCGCTAACCTATGCTATTGCATTAAGGTCATAAACGCCGGATCAACCCAAATATAATAGGGAATCGGGGCGCTGCCCGTCAGCCAGCCCGAACTGTACCCGCAACTGTGAGTAGTTAAAAGAAGCGCCTAGATTCTAGATTCTAGATTCTAGATTCTAGATTCTAGATTCTAAAGCCTAGCACCTTCTTTTCTACAAGTCAGGAGACCTGCCTATTGCTGTTTTCGCTGCGT
Shewanella putrefaciens CN-32
Sputcn32_3176 btuB -343 73.2 TTTTTAGTCAACCTTCTGAGGTGCTTGCGTGCTCAAGCCGCGAGATAATCGGGAAGCCAGTGAGATTCTGGCACTGCCCCCGCAACGGTAAAAGGTGAGAGAAGACCGCGTTTGATAAGTGAGTTCAAGACAGAACCCGATAATCAGAATGTGAAAGGTCAGTCTCGCGTTAATCCAACTTTTAATGGATTAACATAGCCTAAGTCCGGAGACCGGCCCTAAAGGTGTTTTTGAGA
Sputcn32_2963 btuD -355 59.9 CCATAACGTCGCAGAAATAGGTGTTGGGAATAGACTCTCTTGTTCGAATCGCTCCGTTGTTTTCATTCTCAATGGCGTTGTGAACAAAGTGCATATCAACCCAAACATAATAGGGAATCGGGGCGCTGCTTGTCAGTCAGCCCGAACTGTACCCGCAACTGTGAGTAGTAAAAGAAGAACCTAGAACCTAGAACCTAGAACCTAGAACCTTCTTTCCCTACAAGTCAGGAGACCTGCCTATTTCTGTTATCGCTGC
Shewanella sp W3-18-1
Sputw3181_0767 btuB -341 73.2 TTTAGTCAACCTTCTGAGGTGCTTGCGTGCTCAAGCCGCGAGATAATCGGGAAGCCAGTGAGATTCTGGCACTGCCCCCGCAACGGTAAAAGGTGAGAGAAGACCGCGTTTGATAAGTGAGTTCAAGACAGAACCCGATAATCAGAATGTGAAAGGTCAGTCTCGCGTTAATCCAACTTTTAATGGATTAACATAGCCTAAGTCCGGAGACCGGCCCTAAAGGTGTTTTTGAGATT
Sputw3181_0984 btuD -339 60.7 ATAACGTCGCAGAAATAGGTGTTGGGAATAGACTCTCTTGTTCGAATCGCTCCGTTGTTTTCATTCTCAATGGCGTTGTGAACAAAGCGCATATCAACCCAAACATAATAGGGAATCGGGGCACTGCTTATCAGTCAGCCCGAACTGTACCCGCAACTGTGAGTAGTAAAAGAAGAACCTAGAACCTAGAACCTTCTTTCCCTACAAGTCAGGAGACCTGCCTATTTCTGTTATCGCTGCGT
Shewanella sp ANA-3
Shewana3_3472 btuB -339 74.7 TTTTTAGTCAACCTTCTGTGGTGCTTGCGACGCATTCGTCGCGAGATAATCGGGAAGCCAGTGAAATTCTGGCACTGCCCCCGCAACGGTAAAAGGTGAGAGACGACCGCATTCGCTTGGTAGCTCAAGATGAGCCAGAGAATCGAGTGTGCAAAGGTCAGTTTCGCGTTTATCTCTCGTTGAGATAGACATAGCCTAAGTCCGGAGACCGGCCCTAAAGGTGTTTTTGAGA
Shewana3_3280 btuD -348 58.5 CTCAAAGGTCGCAGAAATAGGTGTTGGGAATTTTGCGCGATTTAGTGCTATTGCTTAAGGGCAACAGTGTTCAAGCGCGCCGGATAACCCAAACATAATAGGGAATCGGGGAGCTGCCCGTCAGTAGCCCGAACTGTACCCGCAACTGTGAGTAGTCGAAGCGCTTTGTGTCTTCCCCTACGAGTCAGGATACCTGCCTATTTCTGTTTTCGCTGC
Shewanella sp MR-4
Shewmr4_3302 btuB -341 74.7 TTTTTAGTCAACCTTCTGTGGTGCTTGCGATGCATTCGTCGCGAGATAATCGGGAAGCCAGTGAAATTCTGGCACTGCCCCCGCAACGGTAAAAGGTGAGAGACGACCGCATTCGCTAGGCGTTCAAGAAGAACCCGATAAGCAATGTGAAAGGTCAGTTTCGAGTTAGTCCTTCTATTGCTTGGATTAACATAGCCTAAGTCCGGAGACCGGCCCTAAAGGTGTTTTTGAGA
Shewmr4_0840 btuD -345 59.4 CAAAGGTCGCAGAAATAGGTGTTAGGAATTTTGTGCGATTGAGTGCTATTGCTTAAAGGCAACAGTATTTAAGCGCGCCGGATAACCCAAACATAATAGGGAATCGGGGAGCTGCCCGTCAGTAGCCCGAACTGTACCCGCAACTGTGAGTAGTCGAAGCATTTTGCTTCTTACCTACGAGTCAGGATACCTGCCTATTTCTGTTTTCGCTGCGT
Shewanella sp MR-7
Shewmr7_3182 btuD -347 59.3 CTCAAAGGTCGCAGAAATAGGTGTTAGGAATTTTGTGCGATTGAGTGCTATTGCTTAAAGGCAACAGTATTTAAGCGCGCCGGATAACCCAAACATAATAGGGAATCGGGGAGCTGCCCGTCAGTAGCCCGAACTGTACCCGCAACTGTGAGTAGTCGAAGCGCTTTGCTTCTTACCTACGAGTCAGGATACCTGCCTATTTCTGTTTTCGCTGC
Shewmr7_0651 btuB -342 74.2 TTTAGTCAACCTTCTGTGGTGCTTGCGATGCATTCGTCGCGAGATAATCGGGAAGCCAGTGAAATTCTGGCACTGCCCCCGCAACGGTAAAAGGTGAGAGACGACCGCATTCGCAAGGTAGCTCAAGGTGAGCCAGTGAATCGAGTGTGTAAAGGTCAGTTTCGCGTTAGTCCTTCTATTGCTTGGATTAACATAGCCTAAGTCCGGAGACCGGCCCTAAAGGTGTTTTTGAGATT
Shewanella baltica OS155
Sbal_3366 btuD -266 53.5 TGCCGAGGCACACTGCAAAGGCTTGAAATCAATCTCAACATAATAGGGAATCGGGGAGCTGCTCGTCAGTCAGCCCGAACTGTGCCCGCAACTGTGAGTGACTTTTTATATGTTTTCAATACAAAAAGTGACGAGTCAGGAGACCTGCCTATTTCTGTTATCGCTGC
Sbal_0663 btuB -342 73.6 TTTAGTCAACCTTCTGAGGTGCTTGCGTGCGAAAGCCGCGAGATAATCGGGAAGCCAGTGGAATTCTGGCACTGCCCCCGCAACGGTAAAAGGTGAGAGAAGACCGCGTTTGATTGGTGAGTTCAAGACCGAACCCGATAGTCAGAATGTAAAAGGTCAGTCTCGCGTTAATCCAATTTTTAAGGGATTAACATAGCCTAAGTCCGGAGACCGGCCCTAAAGGTGTTTTTGAGATT
Shewanella denitrificans OS217
Sden_0729 btuB -268 73 TCTAGTCAACCTTTCGTGGTGCCTTTGGCCTTTGGGCCGAGGATAATCGGGAAACCAGTGAAAATCTGGCGCTGCCCCCGCAACGGTGAATATCCTATTTTGGCACTGCCTGAATGGATCAAGCCCGGAGACCGGCCCTAAAGGTGATTTCGATGAT
Shewanella frigidimarina NCIMB 400
Sfri_0824 btuB -354 72.4 TAATAGTCAATCTTTACGGTGCTTGCTTTGGATCGATAGACCAAAGCAGGATAATCGGGAAACCAGTGTAAATCTGGTACTGCCCCCGCAACGGTGATTGGTGAGAGTCAGGTGCGCAACAGTGTTGCGTTAATCATCTCGGCTCGCGTGCGTTTACCTTTAGTGTAACGCCAAAACCTCAGTCCGGAGACCGGCCTTAAAGGTGATTTCGATGAT
Sfri_0874 btuD -211 43.4 ATCTGCGTCGTAACCATAGTGCCTTTCAAGGTATTGGGAATTGGGATAAGCCCAAACTGTACCCGCAACTGTAGATGTACCCATCGAGTATGGGGACATAAGTCAGATACCAGCTTTGAATAGCCTCAATATCCA
Shewanella amazonensis SB2B
Sama_2631 btuB -221 91.2 CTTTATTGTCAGCCTTTTGGGTGCCCGCATCGGCGGGAGAATCGGGAAGTCGGTGTAAATCCGACACTGCCCCCGCAACGGTAATGATGCCAGGCATCTAAGTCCGGAGACCGGCCCAAATCAGGTATAGTGGC
Sama_0760 btuD -250 61 CGGTCATTCACGCCAGGGGTGTCGGGGGCCAAGCCAACCCGACATGAAAAGGGAACCGGGGACATACCATAAGGTATCAGCCCGGACTGTGCCCGCAACTGTGAGGGGGAATACCCCGAGTCAGGATACCTGCCCCTGTGCCTCTTTTATTTTC
Shewanella loihica PV-4
Shew_2990 btuB -316 72.2 AATTTAGTCAACCTTATGTGGTGCCCTAGCCAAAATGGCGCAAGGGATAATCGGGAAGCCAGTGAGAATCTGGCACTGCCCCCGCAACGGTGATAGGTGAGAGCTGGGTGCGCCATGCCTTTAACATCATGGCGTTAAAAAAATCTACGCTCGTCGTTTAAACCCTTTGTTTAGACTTAGCCTCAGTCCGGAGACCGGCCCTTAAGGTGATTTTGAGA
Shew_0712 btuD -281 52.3 GCCTGCGCCGGGAGTATGGTGTCGAGATCGCCAAGGCGATAACTCGGACTTAATAGGGAATTGGGGAAGGCCTCGCGCCGCTAGCCCAAACTGTGCCCGCAACTGTGAGTGTGTTGCCTAGTCGAACCCGACCTGGTCGCCACGAGTCAGGATACCTGCCTACTCTCCAACTACTATCTC
Shewanella pealeana ATCC 700345
Spea_3206 btuB -346 68.8 TATTTTAGTCAACTTTATTGGTGCCTTAAGTTACAGCTGTAACATATACCTATTTGGTATTAGGGATAATCGGGAAGTCAGTTAAATTCTGGCACTGCCCCCGCAACGGTGAATGGTGAGAGACGAGCGCGCCTTAATGGATAGGCGTTTAAAGCTTGTATTCGCGTGTTAGTTTCTAACACTGAACCTAAGTCCGGAGACCGGCCAACAAAGTGATTTCGATG
Spea_3382 btuD -272 45.2 AGCTTATAATAAAAAGTTAGGTGCTTAACGGCATAAAGGGAACCGGAAGCTGACTTCAATGGTTAGCTGAGTCCGGACTGTACCCGCAACTGTAGGAAAGATAGCATTAGGCTATTTTTCAAGTCAGATACCTGCCTAACTGAATGTTGTTCGA
Shewanella halifaxensis HAW-EB4
Shal_3286 btuB -336 76.8 TATTTTAGTCAACTTTACTGGTGCCTTAGGTTACAGCTGTAATCGAGGATAATCGGGAAGTCAGTTAAATTCTGACACTGCCCCCGCAACGGTGAATGGTGAGAGACGAGTGCACCTCAATGGAAAGGTGTTATAAAGCTTGTACTCGTGTGTTAATCGCTGATTGATACAGAACCTAAGTCCGGAGACCGGCCAGCATAGTGATTTCGATG
Shal_3460 btuD -283 43 TAAATAAGAATGAAAGTTAGGTGCTTAACGGCATAAAGGGAACCGGAAGCTGACTGCAAGCAGTGGCTTAGTCCGGACTGTACCCGCAACTGTAGGGAAGCTTAGCCGTAGCGCTGCTTCTAAGTCAGATACCTGCCTAACTGATGTTGTTCAGT
Shewanella piezotolerans WP3
swp_3945 btuB -321 73.8 CTAACTAGTCAACTTTATTGGTGCCTCTGCTTTCAACTTGCGTGTTGGCTGAGGATAATCGGGAAGTCAGTTAAATTCTGACACTGCCCCCGCAACGGTGAATGGTGAGAGACAGGCGCTTTAAAGCTTGTTATCGCATATTGATGACTTCTTCAATATAGAACCTAAGTCCGGAGACCGGCCCGTAAAGTGATTTCGATG
swp_0994 btuD -204 42.8 AAACTAAATTTGAGTTAGGTGCCTAATCGCACAAATTGGGAACCGGTGGCCGAAAACGGCTAATGAGTCCGGACTGTACCCGCAACTGTATGGGAGTGAATTCGTTTTCGCCCCAAGTCAGATACCAGCCTAACTTTGCCATATTGAATA
Shewanella sediminis HAW-EB3
Ssed_3559 btuB -361 59 TATGCTGTCAATCTTTTGTGGTGCCTGCTCTGTCTTTAAGCTTTAACAGCTTAATTAGAGAGTTGGGATAATCGGGAAGCCTGTGAAAATCTGGCACTGCCCCCGCAACGGTGAAAGGTGAAAGTGAGGTGCGCCTATCTATTACAGAATGTAATGGCAGGGTGTTAGAAAAGCCTCTACTTGCTCGGAAAGATCTACCAATCTTACCGAATAGCCTCAGTCCGGAGACCGGCCCATTAGATGATTTTGAGA
Ssed_2165 btuB -339 96.5 ATATTCGCATCGACTTAAGGGCGTTAATTTAACTTAATCGGGAACGTGGTGAGACCCCACGGCTGTACCTGCAACTGTAAACAGAGCGAAACATTATTACCACTGGTAAAACCGGGAAGGAATGTTTCTAGATGCTGTGAGCCAGGAAACCGACCCAGAAGAACTATTGACTC
Ssed_2080 cbiD -334 112.2 AATTTTAACATTATCAGGGAGCCGCACGGCTTAAAGGGGAACCGGATGTAAATTCCGGACTGTACCCGCAACTGTAACTGAGGAGCTAGCTGCAAAGCCACTGACGGTAGTCGGGAAGGCGCAGCAAGCATAGATCCAGGAGTCAGGATACCCGCCTTGATATTGCAGCTGTAAAA
Ssed_2092 cbiN -277 90 TTTTACTCTTTGAAAGAGGGCTATCTGGTGAACTTGGTATTGGGGGAACCGGATGAAATTTTCGGACTGTACCCGCAACTGTAACTGAGGAGCAAACCGCATAACCACTGGCTCAGGCTGGGAAGGTGTGGTGAGCGATGATCCAGAAGTCAGGAAACCCACCTTAATGTCAACACTGGAATC
Ssed_3736 btuD -534 59.1 GGAGAGGATCGCAAAATCAGGTGTTGAGAGCCACTGTCGAAAGATGGGGGTAACTCAAACTTAAAAGGGAACCGGGAGCTTTAGTGAATCGAAAGCATAAGCCCGGACTGTGCCCGCAACTGTGAGTGTTTTGAAGAAGCCGAGAGGTTCTAGGTTCTAGGTTCTAAGTCCTAGAAACTTCTTCAAACCATGAGTCAGGATACCTGCCTAATTTTGTCGCTAAAGA
Shewanella woodyi ATCC 51908
Swoo_3735 btuB -331 57.4 CCTAAGGCTTTATTAAGTCGGATTTTAATGGGAGAGGGAAGGATAATCGGGAAGCCTGTGGAAATCTGGCACTGCCCCCGCAACGGTGAATGGTAAGAGTTAGGCGCGCTTATTTTATCAACAAGATAATGGGTGTTAAAAAAGTCTAAACTTGTGCTGTTTTTCTTTAGGAAATGCAGCAATACCTAAGTCCGGAGACCGGCCCATTTGATGATTTTGAGA
Swoo_4086 btuD -401 44.1 AGGCAGATCCGCAAAGTGAGGTGTTGAGAGCGAGCAAGTGCTGAGTACAACAAAGCGCTTGAAAGTGAACTCAACCTTAAAAGGGAATTGGGGAGTAGCATTTAGCTATTAATGGCCCAAACTGTACCCGCAACTGTATGTGTTTTAAAGAGGTCGTTAGGATCTAACCTAGGACCTAGGACATGAGTACCTCTTTAAACCATGAGTCAGGATACCTGCCTAACTTTGTCGCTAAAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD