Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Corynebacteriaceae

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Corynebacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Corynebacterium glutamicum ATCC 13032
cg0083 pnuX -246 111.8 GTTTTGTTCTCAGGGCGGGGCGAAATTCCCCACCGGCGGTAAGACGAATCATCAGATATGACTAGTTGAGCCCGCGAGCGCCACCAACTAGCAATGGTTTGTGGGTCAGCAGATCCGGTTAAATTCCGGAGCCGACGGTCATAGTCCGGATGCAAGAGAACCGTG
Corynebacterium amycolatum SK46
CORAM0001_0401 pnuX -181 86.6 ATCGCATTCTCAGGGCGAGGTGAAATTCCTCACCGGTGGTGATGCTGCGGCTGACGCAGACAAGTCCACGAGCGCCCTGCCTGTGGCCAGAAGGGTCATCAGGTAGGGGACAAGCAGATTTCGGTTGGAATCCGAAACCGACGGTCATAGTCCGGATGAAAGAGAAGGAGT
Corynebacterium kroppenstedtii DSM 44385
ckrop_0534 pnuX -219 109.6 AGTTCGTTCTCAGGGCGGGGTGAAATTCCCCACCGGCGGTGAACCCCTTCTGACAGAGACGAAGAGGTAAGCCCGCGAGCGCTCTCACGTGCAAGGATGTGCACATGAGGGGTCTAGCAGATCCGGTGTAATTCCGGAGCCGACGGTCACAGTCCGGATGGAAGAGAATGTAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD