Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator NrtR in Corynebacteriaceae

Properties
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Corynebacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Corynebacterium diphtheriae NCTC 13129
DIP2257 nadA -31 4.3 TTATCGCCCGACAGTCGAAAA
Corynebacterium efficiens YS-314
CE1117 nrtR -45 6.2 TTTGAGTCACCGTGACTGTAA
CE1117 nrtR -11 6.1 ATAAAGTCACCTTGACCCTAA
Corynebacterium glutamicum ATCC 13032
cg1218 nrtR -64 6.6 TTAGAGTCAAAGTGACTGTAA
cg1218 nrtR -30 6.5 TTAAAGTCAGATTGACCCTAA
Corynebacterium urealyticum DSM 7109
cur_0072 nrtR -39 5.8 TTAGTGTCAATATGACATTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD