Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Ralstonia

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Ralstonia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Cupriavidus taiwanensis
RALTA_B1130 ribB -326 98.7 TACGTCTTCAGGGCGGGGTGAAAGTCCCCACCGGCGGTATGCCGCGACGCGCAGCGCGCGTCCGGCGAGCCCGCGAGCGCTCGCATTCCCGTGCGAGGTCAGCAGACCTGGTGAGAGGCCAGGGCCGACGGTCATAGTCCGGATGAAAGAAGATGAACGG
Ralstonia eutropha H16
H16_B1223 ribB -309 96 TACGTCTTCAGGGCGGGGTGAAAGTCCCCACCGGCGGTATGCCGCGGCGCGCAGTGCGTGTCCGGCGAGCCCGCGAGCGCTCGCATTCCCGTGCGAGGTCAGCAGACCTGGTGAGAGGCCAGGGCCGACGGTCATAGTCCGGATGAAAGAAGATGGGCGG
Ralstonia eutropha JMP134
Reut_B4029 ribB -336 100.1 TACGTCTTCAGGGCGGGGTGAAACTCCCCACCGGCGGTATGCCGCAGCGTGCGTTTCCGTACGATGCAGCGAGCCCGCGAGCGCCTGCACATGCCGTGCAGGGTCAGCAGACCTGGTGCGATGCCAGGGCCGACGGTCATAGTCCGGATGAAAGAAGATGGGCGG
Ralstonia metallidurans CH34
Rmet_4758 ribB -126 98.9 GCGGAATTCGCATGACCCCATGCGCGCGCGATGTCGTCCATTGCGTGCTGTCGGGGTGTCTTTGCCGTTCTCGCTGATCATCCCCTGAAACGCCCATCCATGGAAATCCACGCACGGAGCGTTTCAATGCTGACCCTTACCAAATCCACCAGCCTTCCTGATT
Ralstonia pickettii 12J
Rpic_4191 ribB -281 108.3 TACGTCTTCAGGGCGGGGTGAAATTCCCCACCGGCGGTATGCGGACCGTGTGTCCGTGAGCCCGCGAGCGCCTTGCATGCGCCTGCATGCAGGGGTCAGCAGATCCGGTGAAATGCCGGGGCCGACGGTCAGAGTCCGGATGGAAGAAGATGTGCGG
Ralstonia solanacearum GMI1000
RSp1191 ribB -170 96.1 GCGGAACGATGCGCGCCCGCGCCGCGGGTGCGGCCTGCCTTGCGCCGGCCGCGCCTTCGCGCGGCGCGGGCGCGCGCTTCCGCGTGCCCTGGAACGTCTTGTCGCCCATTTCAGCGAGGAGCGTTTCCATGTTGTCCACACAGCCATCCCACGCAGTG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD