Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Thermotogales

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Thermotogales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Fervidobacterium nodosum Rt17-B1
Fnod_1415 ribD -239 119.8 GGTACTCTCGGGGCAGGGTGAAATTCCCGACCGGCGGTGAAAGCCCGCGAGCCTTCCGAAAGTTTTTAAGTTTTTTGTAGGAAGGTTGATCCGGTGGAATTCCGGAGCCGACGGTGAAAGTCCGGATGGGAGAGAGTACCAAG
Thermosipho melanesiensis BI429
Tmel_0045 ribD -46 119.5 TGCTATATGCATTTACCTCTCCCTCCTATGAAAAGGAGGGATTTTTTTGGAAAAATACATGAAGCTTGCTATTGAACTTTCAAAAAAAGGTATAGGAAAGGTTTCACCAAATCCCCTAGT
Thermotoga maritima MSB8
TM1828 ribD -61 115.1 GATGTGGAGGTTATATGGGACCCGAGAGGGTCCCTTTTCTTTTACACAGGGAGGGTGTTGTATGTATGAAACTTTCATGAAAAGAGCGATAGAGCTTGCAAAGAAAGGACTTGGAAGGGTGAA
Thermotoga naphthophila RKU-10
Tnap_0999 ribD -180 115.1 AACGCTCTCGGGGCAGGGTGGAATTCCCGACCGGCGGTGAAAGCCCGCGAGCCCTCTCAGGAGGGTTGACCCGGTGGAATTCCGGGGCCGACGGTGAAAGTCCGGATGGGAGAGAGCGTGATG
Thermotoga neapolitana DSM 4359
CTN_0760 ribD -60 112.3 AGAGTGTAGACCATCAGGGACCCGAGAGGGTCCCTTTTCTCTTTAAAAAGGGGTGAAAATGTGTACGAAAGGTTCATGAAAAGAGCAATAGAACTTGCAAAGAAAGGGCTTGGAAGAGTGAAT
Thermotoga petrophila RKU-1
Tpet_1113 ribD -61 115.1 GATGTGGAGATTATATGGGACCCGAGAGGGTCCCTTTTCTTTTACACAGGGAGGGTGTTGTATGTATGAAACTTTCATGAAAAGAGCGATAGAGCTTGCAAAGAAAGGACTTGGAAGGGTGAA
Thermotoga sp. RQ2
TRQ2_0993 ribD -180 115.1 AACGCTCTCGGGGCAGGGTGGAATTCCCGACCGGCGGTGAAAGCCCGCGAGCCCTCTCAGGAGGGTTGACCCGGTGGAATTCCGGGGCCGACGGTGAAAGTCCGGATGGGAGAGAGCGTGATG
Thermotogales bacterium TBF 19.5.1
Kole_1231 ribD -208 119.8 AAATTCTCCGGGGCAGGGTGAAATTCCCGACCGGCGGTGAAAGCCCGCGAGCTCCTGAAGGAGTTGATCCGGTGGAATTCCGGAGCCGACGGTGAAAGTCCGGATGGGAGGAGAATTGATA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD