Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Desulfovibrionales

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Desulfovibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Desulfomicrobium baculatum DSM 4028
Dbac_0862 ribB -71 98.6 GGCCGCCGTTCACGGGCGTGAACGGTTTTTTGCCGCGCCCTGATTCACGCTCAATTCCAAGGAGAACCACCGTGAATCAGACTTCAGAGAATTTCGAGAACACCCCTCCCCGCGTCCGGGTCGAACGCGCCCTTGCGGCCTTGCAACAAG
Desulfovibrio desulfuricans G20
Dde_1050 ribB -293 100.1 CTTATTCTCAGGGCGGGGTGCAATTCCCCACCGGCGGTCAGCCGGCCCGCGGTGATCAGCTCCGCGCCGGCACAGCCCGCGAGCGCCTGCCGTGGCGGCAGGGTCAGCAGATCCGGTGCAATTCCGGAGCCGACGGTCATAGTCCGGATGAAAGAGGATAAGGCA
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Ddes_2290 ribB -156 102.1 TTGCAGCCGCCAATGGCCTTGCGCATGTGCGCCGGGTTTTTGCTGCCGCGTGTGAACTTTTGCCTTCGGGCTGAAGTTTCCGGTGGCATCCCTTTGAGCGGCCCGTCCACGCCCTGATGCACCCTCTCCCGGCACCAGCCGGAAAAGGAG
Desulfovibrio magneticus RS-1
DMR_35270 ribB -267 83.5 GTTGTCCTCAGGGCGGGGTGGAAGTCCCCACCGGCGGTATCCCGGCTTGGCCGGGGAGCCCGCGAGCGCCCGCGACGCATCCGTGTCGCGGGGTCAGCAGACCTGGTGCGAAGCCAGGGCCGACGGTCACAGTCCGGAAGGAAGAGGAAAGACGG
Desulfovibrio piger ATCC 29098
DESPIG_01856 ribB -271 95 TCCATTCTCAGGGCGGGGTGCAAGTCCCCACCGGCGGTGATGGCGGTTTTCCGCATGAGCCCGCGAGCGCCGTACCATGCAACGTGGTGCGGGTCAGCAGATACCGGTGAGATCCCGGAGCCGACGGTAACAGTCCGGATGAAAGAGAACGGTTCG
Desulfovibrio salexigens DSM 2638
Desal_2097 ribB -107 124.8 GACAGTCTTACCGCACGTGGTCTTCCCTACACTTGCGCGCTGTTCCTTTGTGAATAGCTGTCTATTCTATCGCCCTGATTCTGGTAACTGAAATATGGAGATTTACCATGAATCAGAATCTATTATCCCAGTATGGTACCCCTGTTGAGAGGGTA
Desulfovibrio vulgaris Hildenborough
DVU1775 ribB -96 105.1 GGCGGTGGCATCCGTGCCGTGCGAAAGGCTCATGCTTTGCGCATAGACGGAGCCTCTGTCCCTACGCCCTGGTTCATGCCTCACTGGAGGGATTCCATGAATCAGCATCTCCTTGAACAGTTCGGTACGACGCACGAGCGTGTGGAGCG
Desulfovibrio vulgaris str. Miyazaki F
DvMF_2680 ribB -450 88 CGAATCCTCAGGGCGGGGTGAAAGTCCCCACCGGCGGTATTCCCGCGCGGCTTGCCGCGCCGGAGAGCCCGCGAGCGCCCGTTCCGTCGTGGAACGGGGTCAGCAGACCCGGTGAGATGCCGGGGCCGACGGTAACAGTCCGGATGAAAGAGGACGCGGCG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD