Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Bacillales

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Anoxybacillus flavithermus WK1
Aflv_1015 ribD -273 120.9 GCATCCTTCGGGGCAGGGTGAAATTCCCGACCGGCGGTAATGAAACAGTTGTTTCTCAGCCCGCGAGCCGTTAAGGCACGATCCGGTGCGATTCCGGAGCCGACAGTATAGTCTGGATGGGAGAAGGATTGCCA
Bacillus amyloliquefaciens FZB42
RBAM_021420 ribD -133 114.5 AGAGAAGCTATGCAAAAAATAAACTTACTGTATAGTCTTATTTCCTATGGATTAAAACTGGCAAAGCCCCGAACTGTGTAAACATTCGGGGCTTTTTTGACGCCAAATTGCGTGGAAGAAGGGAGGGATAACGATGGAAGAATATTAT
RBAM_021200 ribU -149 125.3 AGGTTCAGCAGACGTTTTGATGCTTATATCAAACGTTTCTTTGCCAAGCCTTAGTAAGCTCCCGCTTTTTAACAAAAGCGGTTTTTTTATTGGGGCGCAAAAGAACCTTTCCTCTTTTCGAGAGATTTGATCGAAA
Bacillus cereus ATCC 14579
BC4109 ribD -421 116.5 GCATCCTTCGGGGTCGGGTGAAATTCCCAACCGGCGGTGATGAAGTGAAAACTTCTAAGTCCGTGACCCGTTTTCAACTCGAAAACGGTGGATCTAGTGAAACTCTAGGGCCGACAGTATAGTCTGGATGGGAGAAGGATATGTT
BC1482 ribU -322 120.3 TCTATCTTCGGGGCAGGGTGAAAATCCCGACCGGCGGTGATGAACTATTTATGATTTTGTTCTAAGCCCGCGAGCCGTTAAGGCAGGATTTGGTGTGATTCCAAAGCCGACAGTATAGTCTGGATGGGAGAAGATGGAGGT
Bacillus clausii KSM-K16
ABC1811 ribE -282 108.7 CTCAACTTCGGGGCAGGGTGTAAATCCCGACCGGCGGTGATAAGGCAATCGCCTTTTAGTCCGTGACCCGCATAAGCATTACTCGTGCGTGCGGTGGATCTGGTGCAAATCCAGAGCCGACAGTAATAGTCTGGATGGGAGAAGTTCGAGCG
ABC3060 impX -250 102.2 GGTATCTTCGGGGCAGGTGAAACTCCTGGCCGGCGGTAAAAGCCCGCGACTCTCCTTTTCTTTTATCAATAAGGGGACTGATTTGGTGGAATTCCAAAGCCGACGGTTAAAGTCCGGATGGGAGAAGATCAACGA
Bacillus halodurans C-125
BH1554 ribD -437 105.2 TTATCCTTCGGGGCTGGGTGGAAATCCCGACCGGCGGTGATGAAGCGAATGCTTCTTAGTCCGTGACCCGGTTGCTGATATCAGTAAGCGGTGGACCTGGTGAAAATCCGGGACCGACAGTGAAAGTCTGGATGGGAGAAGGAAACGTA
Bacillus licheniformis DSM 13
BLi02475 ribD -110 108 AAGAGACTATGTAAAAAATAATGAATAAGCATAGTTTTATTTCTCATGCACAAAAACAACCCCCGGATCAACATCCGGGGTTATTTTTTTGAAAGAAGGGAGGGAAATTCATGACGGATGCGCATTATATGAATCTTGCATTGGAGCTGGCG
BLi02444 ribU -157 124.3 AGGTTCCGCGCGTTTTGAAATGAACATTTTCAAACGTTTATTTGACCTGTCTGTAAAACAGCCCCGCTTTTTCAATAAAGCGGGTTTTTTGTTTAGGACAGGGGAAAGAACCATTCCTCTTTTCGTGAGATGTGA
Bacillus pumilus SAFR-032
BPUM_2061 ribE -255 121 AAGAAAGCTATGAACGAAAAATATTTGTTAATCATAGTTTTATTTCTGATGCAAAAAAGCCACAGCCCCGGAATTTTTCCGGGGCTTTCTGTATGTACATGTAGTGAATAGACCGGCATGCAGTGTTTATTAGGTGATCCCTCA
BPUM_2038 ribU -146 123.8 AGGTTCGTAAACGTTGAAAACTGAGTTTTTCACACGTTTATTTGTCTAGCCTAAATTCCCCGCTCCTGTTTTCATGAGCGGTTTTTTTGTGGCTGAAATTGAACAATCCTCTTTTCGTTAGATTTGATCGAAA
Bacillus subtilis subsp. subtilis str. 168
BSU23280 ribD -131 101.4 ATGAGCCGCTATGCAAAATGTTTAAAAATGCATAGTGTTATTTCCTATTGCGTAAAATACCTAAAGCCCCGAATTTTTTATAAATTCGGGGCTTTTTTGACGGTAAATAACAAAAGAGGGGAGGGAAACAAATGGAAGAGTATTAT
BSU23050 ribU -155 122.7 AGGTTCATAAGCGTTTTGAAATTGAATTTTTCAAACGTTTCTTTGCCTAGCCTAATTTTCGAAACCCCGCTTTTATATATGAAGCGGTTTTTTTATTGGCTGGAAAAGAACCTTTCCGTTTTCGAGTAAGATGTGA
Geobacillus kaustophilus HTA426
GK2297 ribD -208 113.3 CCAATATGCGCACGGCTGTTTTCGGCCGGTTCAGACCCATGGGCAGCGTCTGTCGGCCGACTAGGCATGGTAGTATCTTTTGTTTCCGACCGGCCGGTATAGCCTGCTTAGCGAACGTGTGTTTGTTTGCGCAT
GK1760 ribU -158 118.1 AGGTTTGCCGGCGTTCGTTTTGGCGCATGCGAACGTCTAGTTGCGCACACCCTTTTTCTCCCTTAAGCCTCGTTCGGTTTAAGGGAGTTTTTGTTGGCGCTCGCGGCGGCAGCCTTCTTCTTGTGAGGATGAAT
Oceanobacillus iheyensis HTE831
OB3215 ribE -280 113.1 GCTGTATGGATACGTATATCTATTTGATGTGGAGAAAACGATGTTTTTTCTAGCTGTCTTACATTTACGTATTTTTACACATATCGTTTATTAGAGTTAGCTACGCCCCGCAATCTATATATTGCGGGGCTATTTATATG
OB2329 ribU -153 113.9 CGATCATGTTTGTGTTACACATTTTTTGTGTGCATTTTTGACGATGTATTCAAACCCTAGGGCCTCGCTCTAGGGTTTTATTAATTGTAATACAAACGGTTAATCGTCCTTCATCACAAGATAGG
Paenibacillus sp. JDR-2
Pjdr2_2349 ribD -452 77.1 TTACCTTCGGGGCAGGGTGAAAATCCCAACCGGCGGTGATCGAGCGGCGTCTGCACAACAGGAGTCACCTGCGTGCGGCGCTTTCTCGTCAGTCCGTGACCCGGGCCATCCCATGCAAGAGCGATTCATCGCATTGCGCGGGAAGGAACGGTGGACCTGGTGCAAATCCGGGACCGACAGTATAGTCTGGATGGGAGAAGGGGACACA
Pjdr2_2015 impX -344 106.4 AGGATCTTCGGGGCAGGGTGAAATTCCTGACCGGCGGTAAACGTTAATTCTGCTTGGCAGAGGATAGCAAAGCCCGCGACTCCCTGAGCTGACTAACAGCAAGGGGACTGACTTGGTGCAACTCCAAGGCCGACGGTATAGTCCGGATGATAGAAGATCGCTTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD