Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Staphylococcaceae

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Staphylococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Macrococcus caseolyticus JCSC5402
MCCL_1136 ribU -42 109.5 AGGTTTTCCTCCTCTTTGTAAGATGGATAGAAGGAGAAGGAAATGACACAGATTAATAAGACAAAACGACTCATTACGGTGAGTCTATTAAGTGCGGTTGCTTTTTTACTCATGTTTTT
MCCL_1455 ribD -138 112.4 AGGACACCATTAAGCAATGGTTTATTTGTCGATGTCTTAAATCACAATTAAACTACTTTTTTGGTCTTATTTGTTGAACCTAAATTTCCAATCTCCCGAGCATATTTTGTTCGGGAGATTTTTTTATA
Staphylococcus aureus subsp. aureus N315
SA1316 ribU -63 122.9 AGGTTTTTTGTTGTGCAATAATCCTCCTATTCTTACGAGATGAATGGAAGGAGAAAATTGAATATGCAACAAAATAAACGTCTTATCACAATAAGTATGTTGAGCGCGATTGCGTTTGTGTTAACTTTTATCAAGT
SA1589 ribD -128 123.3 GTTAATTATCGACAAAGATAATGTAGCGTATTTGTAAAAATGTGTACAAATAGGCTTATTTAACGATAAATTTTTCTCCTTGCATCTTAATTCATGATGTGAGGATTTTTGTTTATAGAGGTGATCATTTGAGTCAA
Staphylococcus capitis SK14
STACA0001_1730 ribU -64 113.7 AGGTTTTTTGTTGTGCAAATTTCCTCCTTTTCTAAGCAAGATGAATGGAAGGAGAAAATTAAATATGCAACAAAATAAACGTCTTATAACTATAAGTATGTTAAGTGCGGTTGCGTTTGTATTAACATTTATAAAGTTTCCGCTACCATTC
STACA0001_0662 ribD -134 119.2 ATAATTACTCGACAAGCAAATTTGTAGGACTATGTCTTATAGTAAACAAATATGCTTATTTAAAGATATATTATCAATCTCCTTATGCCTAATTAAATTGGTGTAAGGTTTTTTTATTTTGTTGAGGTGATAAATTGA
Staphylococcus carnosus subsp. carnosus TM300
Sca_1116 ribU -61 123.5 AGGGTTTATTTGTTGTGCTTAAATTCCTCCTATTCGCGTAAGATGAATGGAAGGAGTATTTATGAATCAGCAAAAAAACAAACGCTTAATCATTATAAGTATGATGAGTGCAATTGCGTTTATTTTGATGTTTA
Sca_1375 ribD -176 124.4 GAAGACGTCATTAAATATGAAACTCATTTATTAATATTATATATGAGGTTTAATTTGATTCGGCTTATTTAAGTACGCAATTTTATCGAATTACCTTTTAATATTAATAAATCATCATAAATTCTTTCCCGTT
Staphylococcus epidermidis ATCC 12228
SE1174 ribU -64 113.4 AGGTTTTTTGTTGTTCAAATTTCCTCCTTTTCTAAGTAAGATGAATGGAAGGAGAAAATTATATATGCAACAAAACAAACGTTTGATTACAATTAGTATGTTAAGTGCGGTAGCGTTTGTGTTAACTTTCATCAAGT
SE1441 ribD -151 115.4 TTGAATTATCGACTTACACAAATTCGTGTAGTTATGATAAGCGTATTGTATACTTATGTGCAATTTTTAGTATGCTAATAGGCTTATTTAAAGATATAGATATCTCCTTATGCCTACAATATAGGTATAAGGTTTTTTTT
Staphylococcus haemolyticus JCSC1435
SH1427 ribU -190 120.8 TTCATCTTCGGGGTAGGGTGCAATTCCCAACCGGCAGTAAATTAAGCCTGCGACCCGCTTCTTTGAAGTGGCTGATTCAGTGGAAATCTGAAGCCGACAGTATAGTCTGGATGGAAGAAGATGGAGGT
SH1153 ribD -280 115.4 AATTCTTTCGGGGCGGGGTGCAATTCCCAACCGGCAGTAATATAAGCCTGCGACCTGTCAAAGTGAAAGGTAATAACTTTGATGGCTGATCTAGTGAGATTCTAGAGCCGACAGTGAAAGTCTGGATGGGAGAAAGAATGAGA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
SSP1262 ribU -148 125.8 TTCATCTTCGGGGTAGGGTGCAATTCCCAACCGGCAGTAAATAAAGCCTGCGACCCATTTTATTATATATAATAAAATGGCTGATCTAGTGAAAATCTAGAGCCGACAGTAAAGTCTGGATGGGAGAAGATGGAGGA
SSP0995 ribD -293 125 TATTCTTTCGGGGCAGGGTGAAATTCCCAACCGGCAGTAAATTAAGCCTGCGACCTGCATTTATGTGTATAAATGTGGCTGATCTAGTGAGATTCTAGAGCCGACAGTAAAGTCTGGATGGGAGAAAGAATGAAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD