Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Enterobacteriales

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Citrobacter koseri ATCC BAA-895
CKO_04434 ribB -107 108.1 CGATCCAGTCGGGCATGGGCCCGCTCACGTTATTTTTTTGCCGCTTGTCGGTACTCCTAAGACTGCCCTGATTCTGGTAACCATAATTTTAATGAGGTTTTTTTACCATGAATCAGACGCTACTTTCCTCTTTTGGTACGCCTTTTGAACGTGTGGAACATGCGCTATCCGCGCTGCGTGAAGGACGCGGTGTGATGGTGCTTGACG
Edwardsiella tarda EIB202
ETAE_0472 ribB -140 115.9 CTTATTCTCAGGGCGGGGTGAAAGTCCCTACCGGCGGTAAATTGGTACGCTTCGGCGTCACTGAAAGCCCGCGAGCGCTCGCACGACCATGCGGGGTCAGCAGATCCGGTGTAATTCCGGGGCCGACGGTTACAGTCCGGATGGGAGAGAGTAACGAT
Enterobacter sp. 638
Ent638_3453 ribB -107 123.7 CGATCAAGTCGGGCACGGCCCGCTCACGTTATCTTTTTGCCGCTTATACGGCGCTCCTAAGACTGCCCTGATTCTGGTAACCATAATGTTAATGAGGTTTTTTTACCATGAATCAGACGCTACTTTCCTCTTTTGGCACTTCTATTGAACGT
Erwinia amylovora ATCC 49946
EAM_2992 ribB -109 123.6 CGATTCTTGACGGGCTGATGCTCGCCACGCGTTATTTGTTGTCACCGCATAACACTCCTAAGCATGCCCTGGTTCTGGTAACCCATACATTTATTAAGGTTTATTTACCATGAATCAGTCGCTACTTTCTGAATTTGGCACGCCTGAACA
Erwinia carotovora subsp. atroseptica SCRI1043
ECA0899 ribB -327 108.6 CTTATTCTCAGGGCGGGGTGTAATTCCCCACCGGCGGTAAACCAGTGAACGTATGAACGAATAAGGTTCTGCGCACTGGAAGCCCGCGAGCGCTCAGGCTGTGTTTTCCGATATCAATTGTCGGTTTTCGCAACATGAGGTCAGCAGACCCGGTGTAATTCCGGGGCCGACGGTTAAAGTCCGGATGGGAGAGAGTAACGGT
Escherichia coli str. K-12 substr. MG1655
b3041 ribB -105 123.5 CGATTCTGTCGGGCATGGACCCGCTCACGTTATTTTGGCTATATGCCGCCACTCCTAAGACTGCCCTGATTCTGGTAACCATAATTTTAGTGAGGTTTTTTTACCATGAATCAGACGCTACTTTCCTCTTTTGGTACGCCTTTCGAACGT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
KPN_03454 ribB -107 121.3 CGGCACAGTCGGGCCCAGGCCCGCTCGCGTTGACTTTTGCCGCTAAACCGGCGCTCCTAAGACTGCCCTGATTCTGGTAACCATAATTTTAATGAGGTTTTTTTACCATGAATCAGACGCTCCTTTCTTCTTTTGGTACCGCTTTTGAACGTG
Photorhabdus luminescens subsp. laumondii TTO1
plu3963 ribB -147 101.8 CGGCATCTGTCGGGCTTTGTGCTCGCCTGTTGTTCCGGCTATGGTATTCACACATGATATTAATGTTATGGCATGATGTTATAGCGAGAACTCCTCAAGACCGCCCTGATTCTGGTAATCCATAAATTTTAATGAGGTTTCTTTACCATGAATCAGACGCTACTTTCTGAATATGGCAC
Proteus mirabilis HI4320
PMI2353 ribB -126 116.3 AATAGCATCAGTGGGATCCTTGTATCCATTCCTGTTGTTTCTGCTTGTCTATTTATACAGCAGAGATCCACTCCTAAGACTGCCCTGGTTCTGGTAACTTTCATTAATTATTGAGGTTTTTTTACCATGAATCAGACGCTACTTTCCGAATTTGGCTCTC
Salmonella typhimurium LT2
STM3195 ribB -107 109.6 CGATCCAGTCGGGCATGGACCCGCTCACGTTATTTTTTTGCCGCTTGTCGGCACTCCTAAGACTGCCCTGATTCTGGTAACCATAATATTAATGAGGTTTTTTTACCATGAATCAGACGCTACTTTCCTCTTTTGGTACGCCTTTTGAACGTGTTGAACTTGCACTGGATGCGCTGCGTGAAGGACGCGGTGTGATGGTG
Serratia proteamaculans 568
Spro_4286 ribB -112 118.2 CGGTATCTGCCGGGTTTGCGCCCGCTTGCGTTATTTTTTTAGCTATTGCTAGCTACTCCTCAAGATCGCCCTGGTTCTGGTAATCCATAATTTTCTAATGAGGTTTTTTACCATGAATCAGACCCTACTTTCAGATTTCGGCACGCCGGTAGAACGCGTAGAA
Yersinia pestis KIM
y3520 ribB -243 111.8 CGGTATCTGCCGGGCTTATACACCTATAGATTTCAAGATGCGGGGCGTTGGTCATCACGAAGATCCTAAGGTGCTTACATGAGTAAGCGATTTGGGGGAACGAGAACAACCAACATCTTTGTCGCTTGGAAAATAACGGATATGGTCCGCTTGCGTTATTTCGGCTATTTATTTTTGGCCTTTTACTCCTC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD