Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Shewanellaceae

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Shewanellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Shewanella amazonensis SB2B
Sama_0143 ribB -208 66.6 ATCCCTGTCAGCCAGGCTCAGTCCGGATGGGAGAGAATGGTCGAGAATATCCGGTGATGACACTGTCTCAGCCCCGGCTGAAACGCGCTGCCTGCTGTCTGACGACTGCGGTCAGTACCGGCTTTCGCACCTTAACACCTTGCCGTGTGGCACAGGTGGATCCTGCTATGCC
Shewanella baltica OS155
Sbal_4219 ribB -420 52.6 CAAATTCTCAGGGCGGGGTGAAACTCCCCACCGGCGGTAAATGGGTAACGCTAAGTGATTATTTAACTGAGCATCCCCAAAGCCCGCGAGCGCCCGAAATCACTTTCGGGGTCAGCAGATCTGGTGCCTTAGATTTTGCCTAGTGCAAAACTGACTATTCCAGAGCCGACGGTAATGGACTGTTTGCTTTAATGGCGACAGTACTGAG
Shewanella frigidimarina NCIMB 400
Sfri_3868 ribB -263 113.1 ATAATTCTCAGGGCGGGGCGCAATTCCCCACCGGCGGTAAACTTGAAAAAGTGAGCCCGCGAGCGCTCGATTCGTCGAGGTCAGCAGATCTGGTGACTTAGGTTTTACTCATGAGTAATGCCTAACAGTCCAGAGCCGACGGTTACAGTCCGGATGAGAGAGAATAGAGAT
Shewanella halifaxensis HAW-EB4
Shal_4187 ribB -432 46.3 ATAATTCTCAGGGCGGGGTGTAACTCCCCACCGGCGGTAAGTTATGGTGTGAATGTTGATCCCACTGTAAAAGCCCGCGAGCGCCTAGTTTACGCTATTAAATATCAATATTAATAGCTGCGAATATTAAC
Shewanella loihica PV-4
Shew_0040 ribB -368 89.2 TACATTCTCAGGGCGGGGTGAGACTCCCCACCGGCGGTAATCATCCTATGGGATGTCAGCCCGCGAGCGCCTATTTGCATCTAGGTATTAGTGTGCAGCTAGGGTCAGCAGATCTGGTGAAGTGTGCAACAAGCCATCTATTCCAGAGCCGACGGTAATGAGCACCGAGTGCACTAAGTCCGGATGAAAGAGAATATAAGA
Shewanella oneidensis MR-1
SO_0142 ribB -239 43.2 TTTGCCACTAGCGACAGTACTGAGTCCGGATGGAAGAGAATGTAAGACAACACTCGGATAATTGGCATTAACTTTGGCTAAGTATCCAAGCTGTTAGCCTCATATTTTGCAATCACGTTTTTAAGCCTGCGCTTAAAGGGGTCGATTGCTACAGCACAATCCCCTTTGGGGTAATGGCTGTATTTCTGTACGCCC
Shewanella pealeana ATCC 700345
Spea_0131 ribB -306 46.6 TAACTAGGGTCAGCAGATCTGGTAAACAGACCTTATCAAAGACGCTCGTCATACGTAAGGTTGTACCTACTCCAGAGCCGACGGTAATGAGTACTGACTAACCAAGTGAGTACACTGAGTCCGGA
Shewanella piezotolerans WP3
swp_0169 ribB -242 45.9 TGCTGCGCACTATGTGCATTGCGTGTACTAAGTCCGGATGAAAGAGAATATAAGATTGAACAAGTTTGCTTTTACAAGCTGCTTCAGTGTGTTTTGCCGCGTGCAGATCCCCTAATGCAGCCTGCTTGAACAAAATTGAATTCACCTCTTATTAAGCACATGCATCTATCTATGATGCAGGTGTCATTTT
Shewanella putrefaciens CN-32
Sputcn32_0134 ribB -229 49.5 TGGCAACAGTGCTGAGTCCGGATGGAAGAGAATGTAAGACGGCACTTTGCGGCACCCGTGTATAAACATGCTCAGTATCGCACAGTGTTAGCCTCATGTTTTGCAATAGCTTCACCCAGTGAAGTGATATTGCTACAGCAAAATCGAACCATTAGGTTTGGTTAAGTTGTATTCCTGCACGCCCTGATTCTGGA
Shewanella sediminis HAW-EB3
Ssed_4372 ribB -455 44.4 TAAATTCTCAGGGCGGGGTGAAACTCCCCACCGGCGGTGATAGCTTTCAGGTCAGCCTGAAACTTAAGCCCGCGAGCGCCCAAACCGACTTAACTATCCTCGAAGAACTATCTTCGAAGATTGTCAGTTTGGGG
Shewanella sp ANA-3
Shewana3_0134 ribB -303 42.2 ATGCCTATCGAGCGCTACTATTCCAGAGCCGACGGTAATGGACTGTTTGCCATCATAGCAACAGTACTGAGTCCGGATGGAAGAGAATGTAAGACAACATTAGGATACGGGCGCTTCGTTTCAGCCAATGAGCGAAAGCTACCG
Shewanella sp MR-4
Shewmr4_0135 ribB -323 39.2 GCTTGTCTCGTTATGGTTAACGCCTATCGAGCGCTACTATTCCAGAGCCGACGGTAATGGACTGTTTGCAAACATTGCAACGGTACTGAGTCCGGATGGAAGAGAATGTAAGACAACATTAGGATGC
Shewanella sp MR-7
Shewmr7_0129 ribB -259 41.9 TTTGCCAGCATAGCAACGGTACTGAGTCCGGATGGAAGAGAATGTAAGACAACATTAGGATGCAGGCGCTTCGTTTCAGCCAATGAGCGAAAGCCATCGTCATCTAAATGTTAGCCTCATATTTTGCAATTAGCCGACGTAAGCCACTGAGCTTAAATGGGTCTATTGCTACAGCTCAATCCCCATTGGGG
Shewanella sp W3-18-1
Sputw3181_3938 ribB -397 24.8 GAAACTCCCCACCGGCGGTAAATGAGTAACGGCTAAGTGATGGTGACTTAGTGTGGCTCAAAGCCCGCGAGCGCCCGAAATACTTCGGGGTCAGCAGATCTGGTGCCTCAGTGTTTGCCGAGTGCAAATCTGATATTCCAGAGCCGACGGTAATGGACTGTG
Shewanella woodyi ATCC 51908
Swoo_4764 ribB -401 52.7 TAAATTCTCAGGGCGGGGTGAAACTCCCCACCGGCGGTGATAGCGCTTAAATTAACCTAAGCCTTAAGCCCGCGAGCGCCCAAATCAACTTAACATTGAAGATGTAAGCTGATTTGGGG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD