Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator DESPIG_02495 in Desulfovibrionales

Properties
Regulator family: ArsR
Regulation mode:
Biological process:
Effector:
Regulog: DESPIG_02495 - Desulfovibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Desulfovibrio piger ATCC 29098
DESPIG_02495 null -89 6.3 TAAAACTATAAAACTAGTTTTT
DESPIG_02495 null -81 6.8 TAAAACTAGTTTTTTAGTTGAC
DESPIG_02495 null -55 6.8 TGAAACTACTTTTTTAGTTTGA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD