Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator DMR_45340 in Desulfovibrionales

Properties
Regulator family: ArsR
Regulation mode:
Biological process:
Effector:
Regulog: DMR_45340 - Desulfovibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Desulfovibrio magneticus RS-1
DMR_45340 null -92 6.3 TTGTTCCGTTTTTACGAACTA
DMR_45350 null -86 6.3 TAGTTCGTAAAAACGGAACAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD