Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Dbac_0377 in Desulfovibrionales

Properties
Regulator family: ArsR
Regulation mode:
Biological process:
Effector:
Regulog: Dbac_0377 - Desulfovibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Desulfomicrobium baculatum DSM 4028
Dbac_0377 null -45 7.7 TTATCGTAATTCTACGATAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD