Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator ArsR3 in Desulfovibrionales

Properties
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector:
Regulog: ArsR3 - Desulfovibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Desulfovibrio vulgaris str. Miyazaki F
DvMF_2392 arsR3 -29 6.6 CAGTTCAACATTCGTTGTATTA
DvMF_2391 arsD -65 5.7 CAGTACAACAAGCATTGGCGTG
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Ddes_1926 arsM -43 6.3 CAAGGCAACATTAGTTGAATAG
Ddes_1925 arsR3 -29 6.3 CAATTCAATATAAGTTGAAATA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD