Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator ArsR2 in Desulfovibrionales

Properties
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector:
Regulog: ArsR2 - Desulfovibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Desulfovibrio desulfuricans G20
Dde_2790 null -143 5.6 ATTTTGATGACACTCAAAAT
Desulfovibrio salexigens DSM 2638
Desal_2205 null -34 5.4 AATTTGCCAAATATAAACAT
Desal_2205 null -42 5.7 ATTTGGTTAATTTGCCAAAT
Desulfovibrio magneticus RS-1
DMR_01880 arsC -226 5 ATTTTGGTAGTTTGAAAAAT
Desulfomicrobium baculatum DSM 4028
Dbac_2827 arsR2 -46 5.6 GTTTTGACATCTTGACATAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD