Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator ArsR in Desulfovibrionales

Properties
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector: Arsenate
Regulog: ArsR - Desulfovibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Desulfovibrio vulgaris Hildenborough
DVU1645 arsR -44 6 ATTTGTCTATTTTGCCAAAT
DVU1645 arsR -36 5 ATTTTGCCAAATAATCAAGT
DVU1646 arsC -142 5 ACTTGATTATTTGGCAAAAT
DVU1646 arsC -134 6 ATTTGGCAAAATAGACAAAT
Desulfovibrio vulgaris str. Miyazaki F
DvMF_2281 arsR -12 5 ATTTGGCGAAACATGCAAAT
Desulfovibrio desulfuricans G20
Dde_2776 arsR -11 5.1 GCTTGGCCTAATTGCCAAAT
Dde_3721 arsR -88 5.7 ATTTGGCTGAATCGCCAAAT
Dde_3721 arsR -39 5.7 ATTTGGCGAAAAAGCCAAAT
Dde_2777 null -31 5.5 ATTTGGCGAATCAGCCAAAC
Desulfovibrio piger ATCC 29098
DESPIG_02962 null -30 5.2 ATTTGGCAATTTTGCCAATA
DESPIG_02962 null -22 4.5 ATTTTGCCAATAAGGAATAT
DESPIG_02964 arsR -31 5.6 ATTTTGCCAAATGACCAAAT
Desulfovibrio salexigens DSM 2638
Desal_2313 arsC -38 4.6 GTTTTCCTCTTTGGCAAAAT
Desal_2313 arsC -30 5.3 CTTTGGCAAAATATCCAAAC
Desal_3295 arsR -42 5.4 ATTTTTATATTTTGCCAAAC
Desal_3295 arsR -34 4.8 ATTTTGCCAAACAGGAAAGT
Desal_3294 null -39 4.3 AGTTTCGTATTTGGCAAAAT
Desal_3294 null -31 4.9 ATTTGGCAAAATATAAAGAC
Desulfovibrio magneticus RS-1
DMR_37400 Desal_3293 -76 5.4 ATTTGGCAAAACATACAAAT
DMR_37390 arsR -39 4.6 ATTTTGCCAAATAGAAAACG
DMR_37390 arsR -47 5.7 TTTTGGCTATTTTGCCAAAT
DMR_37400 Desal_3293 -84 5.7 ATTTTGCTATTTGGCAAAAC
DMR_20130 null -57 5.3 ATTTTGCCTTTTGACCAAAT
DMR_20130 null -49 4.4 TTTTGACCAAATAGCAAATC
Desulfomicrobium baculatum DSM 4028
Dbac_1906 arsR -160 5 ATTTGCACAAATGACCAAAT
Dbac_1906 arsR -38 5.1 GCTTGGCAATATTGCCAAGT
Dbac_1905 arsR -32 5 ATTTGGTCATTTGTGCAAAT
Dbac_1905 arsR -154 5.1 ACTTGGCAATATTGCCAAGC
Desulfohalobium retbaense DSM 5692
Dret_1784 arsR -12 4.2 ACTTTGCCAAGTATGCAAAC
Dret_1783 null -49 5.2 ATTTGGCTTTTTGGGAAAAT
Dret_1783 null -42 3.7 TTTTTGGGAAAATAGAAAAT
Dret_1784 arsR -20 5 ATTTGGTTACTTTGCCAAGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD