Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AraR in Bacillales

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Regulog: AraR - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus subtilis subsp. subtilis str. 168
BSU33970 araR -48 6 TAATTAGTACGTACAAATAT
BSU33970 araR -91 5.5 TCAATTGTACGTACTTATAT
BSU28510 xsa -173 5.5 AAATACATACGTACAAATAT
BSU28800 araA -103 5.9 AAAATTGTTCGTACAAATAT
BSU28810 abnA -159 5.2 TTTTTTGTCTGTACAAATTA
BSU33960 araE -190 5.3 AAATGTATACGGACAAATTT
BSU33960 araE -109 6 ATATTTGTACGTACTAATTA
BSU33960 araE -66 5.5 ATATAAGTACGTACAATTGA
Bacillus amyloliquefaciens FZB42
RBAM_025570 xsa -169 5.6 TAATTGGTTCGTACAAATTA
RBAM_025860 araA -57 5.3 ATATTCGTACGTATATTTTT
RBAM_031330 araR -167 5.6 ACATTTGTACGTACTTATGA
RBAM_031330 araR -124 5.4 AAATTAGTACGCACAAATAA
RBAM_025860 araA -99 5.8 AAAATTGTTCGTACAAATAA
RBAM_025870 abnA -105 5.2 TTTTTTGTCTGTACAAATAT
RBAM_031320 araE -152 5.4 TTATTTGTGCGTACTAATTT
RBAM_031320 araE -109 5.6 TCATAAGTACGTACAAATGT
Bacillus pumilus SAFR-032
BPUM_2330 araR -191 6.1 ATATTTGTACGTACATATGT
BPUM_2329 araK -102 6.1 ACATATGTACGTACAAATAT
Bacillus licheniformis DSM 13
BLi03028 araA -125 5.7 TTAGTTGTACGTACATATAA
BLi02061 araR -160 5 TAATATGTTCATATAAATAT
BLi02061 araR -192 5.8 TTTTTTGTACGTACATATGT
BLi02062 araK -138 5 ATATTTATATGAACATATTA
BLi02062 araK -106 5.8 ACATATGTACGTACAAAAAA
BLi03028 araA -155 5.2 GAAGTTGTTCGTACAAATAT
Anoxybacillus flavithermus WK1
Aflv_0528 araR -81 5.9 AAATATATACGTACAAATAA
Aflv_0529 araD -54 5.7 AAAAATGTACGTACAAAATT
Geobacillus kaustophilus HTA426
GK1910 araF -36 5.7 TTAAATATACGTACAAATTT
GK1907 araR -75 5 ATAATGATACGGACAAATAA
GK1906 araD -61 5.6 AAAATTGTACGTACAATAGT
Bacillus halodurans C-125
BH1061 BH1061 -172 5.6 TTATTCGTACGAACAAATAA
BH1861 abfA -198 6.1 AAATTTGTACGTACAAAAAA
BH1861 abfA -100 5.5 TATTATGTACGTACAAGTTA
BH1871 araD -71 5.7 AAAATTGTACGTACAAGTGT
BH1875 araR -36 5.2 TCATTTGTACGTATAAGTTG
BH0902 araP -49 4.4 AAACGTGTACGTACACGATA
Oceanobacillus iheyensis HTE831
OB2800 araR -203 5.4 ATTATTGTACGTACATTTGT
OB2800 araR -170 5.9 ATATATATACGTACAAATTA
OB2800 araR -63 5.3 AAATATGTACATACAAGTAT
OB2799 araK -152 5.9 TAATTTGTACGTATATATAT
OB2799 araK -119 5.4 ACAAATGTACGTACAATAAT
Paenibacillus sp. JDR-2
Pjdr2_4209 araK -100 4.8 TCACATGTACATACAAGTTA
Pjdr2_4207 araD -62 5.3 AAACATGTACGTACAAGTGT
Pjdr2_2502 araA -83 5.6 TAAGTTGTACGTACAACTTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD