Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator DctR in Bacillales

Properties
Regulator family: OmpR
Regulation mode: repressor
Biological process: C4-dicarboxylate transport
Effector:
Regulog: DctR - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus subtilis subsp. subtilis str. 168
BSU04470 dctA -115 4.3 AGACCAAAAAGACCAAAATGTCCGTTATGATCATAA
Bacillus amyloliquefaciens FZB42
RBAM_004800 dctA -105 4.3 AGACCAAAAAGACCAAAATGTCCGTTATGATCATAA
Bacillus pumilus SAFR-032
BPUM_0419 dctA -123 4.3 AGACCAAAAAGACCAAAATGTACGATATGTACATAA
Geobacillus kaustophilus HTA426
GK0561 dctA 71 4.3 AGACCAAAAAGACCAAAACGACCATTATCACCATAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD