Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FruR in Thermotogales

Properties
Regulator family: DeoR
Regulation mode: repressor
Biological process: Fructose utilization
Effector: Fructose-1-phosphate
Regulog: FruR - Thermotogales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Thermotoga sp. RQ2
TRQ2_0642 fruR -62 4.2 ATCACAATATGTCATAATCAATCATAAAGCGATCACAA
Thermotoga naphthophila RKU-10
Tnap_0927 fruR -61 4.2 ATCATAATACGTCATAATCAGTCATGAACCGATCACAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD