Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GudR in Bacillales

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Glucarate utilization; Galactarate utilization
Effector:
Regulog: GudR - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus subtilis subsp. subtilis str. 168
BSU02500 gudR -42 5.5 CTATTTTGTCTTACAATTGAA
BSU02460 kdgD -117 7 TTTATTTGTCTTACAATTAAA
Bacillus licheniformis DSM 13
BLi00284 kdgD -119 7 TTTATTTGTCTTACAATTAAA
Bacillus clausii KSM-K16
ABC0471 kdgD -51 6.5 TTAATTTGTCTTACAATAAAA
ABC0472 gudR -63 5.9 CCTATTTGTATTACAATTAAA
ABC0466 ABC0466 -50 5.9 TCTATTTGTCTTACAATTAAT
Oceanobacillus iheyensis HTE831
OB2842 gudR -90 6.6 TTTATTTGTCGGACAAATAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD