Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BmrR in Bacillales

Properties
Regulator family: MerR
Regulation mode: activator
Biological process: Multidrug resistance
Effector:
Regulog: BmrR - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus subtilis subsp. subtilis str. 168
BSU24010 bmr -63 4.7 GACTCTCCCCTAGGAGGAGGTCT
Bacillus licheniformis DSM 13
BLi02783 BLi02783 -257 7.2 GACCCTATAGTTGCTATAGGGTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD