Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FrlR in Bacillales

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Fructoselysine utilization
Effector: Fructoselysine 6-phosphate
Regulog: FrlR - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus subtilis subsp. subtilis str. 168
BSU32600 frlO -54 6.1 TAGACTATAATGTTATATAACA
BSU32600 frlO -44 6.1 TGTTATATAACATTATAGTCTA
BSU32550 yurJ -144 6.5 TGTATTATGACGTTATAATACA
BSU32610 frlB -61 5.3 TTTAATATAACAATATATAATG
BSU32610 frlB -41 6.7 TGTTATATAACGTTATATAATA
BSU32560 frlR 1 6.5 TGTATTATAACGTCATAATACA
Bacillus amyloliquefaciens FZB42
RBAM_029660 frlO -32 5.2 CGGACTATAATGATATATAACG
RBAM_029660 frlO -22 5.8 TGATATATAACGTTATAGTCCG
RBAM_029610 yurJ -116 6.5 TGTATTATGACGTTATAATACA
RBAM_029670 frlB -43 6.6 TGTTATATAACATTATATAATA
RBAM_029670 frlB -63 5.5 ATTAATATAACGTTATATAATG
RBAM_029620 frlR -61 6.5 TGTATTATAACGTCATAATACA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD