Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BltR in Bacillales

Properties
Regulator family: MerR
Regulation mode: activator
Biological process: Multidrug resistance
Effector:
Regulog: BltR - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus subtilis subsp. subtilis str. 168
BSU26590 blt -104 6.6 GACTATACGGTAACCATATACCT
Bacillus amyloliquefaciens FZB42
RBAM_006040 bltD -120 6.4 GACTATACGGTAACCATATCCTT
Bacillus pumilus SAFR-032
BPUM_1819 yrkN -32 5.7 GACTATGGAGTTACTCCACCCTT
Bacillus halodurans C-125
BH4045 BH4045 -65 5.9 GACTATCGTGTTACACCACACCT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD