Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator SufR in Cyanobacteria

Properties
Regulator family: [Other]
Regulation mode: repressor
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: SufR - Cyanobacteria
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Synechococcus sp. PCC 7002
SYNPCC7002_A1815 sufR -39 5.8 TTTAACAACAAAAAAGTTGTCAAA
SYNPCC7002_A1443 nifJ -152 5.1 TTTAGCAAGCATTTTGTTGTTAAA
SYNPCC7002_A1814 sufB -145 5.2 TTTGACAACTTTTTTGTTGTTAAA
SYNPCC7002_A1814 sufB -104 5.6 TAAAACAACCAAACAGTTGTTAAA
SYNPCC7002_A1815 sufR -80 5.5 TTTAACAACTGTTTGGTTGTTTTA
Synechocystis sp. PCC 6803
sll0088 sufR -163 5.6 TAAAACAACAGGTAAGTTGTTTTA
sll0088 sufR -123 5.6 ATTAGCAACCCGATTGTTGTCAAA
sll0741 nifJ -172 4.9 AAAAACAATCTTGACGTTGTTTAA
slr0074 sufB -116 5.3 TAAAACAACTTACCTGTTGTTTTA
Cyanothece sp. ATCC 51142
cce_0953 nifJ -133 5.6 AAAAACAACCCTAATGTTGTGTTA
cce_0685 sufB -155 4.8 TTTGACAACAATTGAGTTGTTAAT
cce_0685 sufB -115 5.8 TAAAGAAACATAAATGTTGTTTTA
cce_1005 sufD -137 5.8 TTTAACAACATTTTTGTTGCTAAA
cce_0683 sufR -109 5.7 ATTAACAACTCAATTGTTGTCAAA
cce_0683 sufR -149 5.7 TAAAACAACATTTATGTTTCTTTA
Cyanothece sp. PCC 8801
PCC8801_0414 sufR -160 5.6 AATAACAACCCCATTGTTGTCAAA
PCC8801_0414 sufR -200 5.7 TTAAACAACATTTTTGTTGCTCAA
PCC8801_3918 nifJ -134 5.5 AAAAACAACCATGAAGTTGTCTTA
PCC8801_0415 sufB -188 4.8 TTTGACAACAATGGGGTTGTTATT
PCC8801_0415 sufB -148 5.9 TTGAGCAACAAAAATGTTGTTTAA
Cyanothece sp. PCC 7425
Cyan7425_3450 sufB -106 5 TTAGACAACTGATGTGTTGCTAAA
Cyan7425_3450 sufB -67 5.3 TTAAGCAACGCCTGAGTTGTTTAA
Cyan7425_3451 sufR -74 5.8 TTTAGCAACACATCAGTTGTCTAA
Cyan7425_3451 sufR -113 5.5 TTAAACAACTCAGGCGTTGCTTAA
Microcystis aeruginosa NIES-843
MAE_23100 sufR -182 5.9 TTAAACAACAATAAAGTTGTTTAA
MAE_23100 sufR -142 5.7 ATTAACAACAAAGCTGTTGTCAAA
MAE_23090 sufB -105 5.1 TTTGACAACAGCTTTGTTGTTAAT
MAE_23090 sufB -65 5.9 TTAAACAACTTTATTGTTGTTTAA
Nostoc sp. PCC 7120
all2491 sufR -101 5.9 TAAAACAACATCGATGTTGTTTAA
all2491 sufR -56 5.7 ATTAACAACAACAATGTTGTCAAA
alr2492 sufB -193 5.2 TTTGACAACATTGTTGTTGTTAAT
alr2492 sufB -148 6 TTAAACAACATCGATGTTGTTTTA
Trichodesmium erythraeum IMS101
Tery_4355 sufB -62 6 TTAAACAACAAATAAGTTGTTTAA
Tery_4354 sufR -212 6 TTAAACAACTTATTTGTTGTTTAA
Synechococcus elongatus PCC 7942
Synpcc7942_1734 ftrC -101 5.1 TTTGACAACATTGATGTTGTTCAA
Synpcc7942_1734 ftrC -63 5.1 TTAAGCAACGTCTGTGTTGTTCAA
Synpcc7942_1733 sufR -98 5.7 TTGAACAACATCAATGTTGTCAAA
Synpcc7942_1733 sufR -136 5.7 TTGAACAACACAGACGTTGCTTAA
Prochlorococcus marinus str. MIT 9313
PMT1607 sufR -204 5 AAACGAAACCTATTGGTTTCGTTT
PMT1606 sufB -194 5 AAACGAAACCAATAGGTTTCGTTT
Synechococcus sp. JA-3-3Ab
CYA_2190 sufB -67 5.3 TTAAGCAACAACCGTGTTGTTTTA
CYA_2189 sufR -119 6 TAAAACAACACGGTTGTTGCTTAA
Synechococcus sp. WH 8102
SYNW0318 ftrC -39 4.9 TAAGGAAACCAGGTCGTTTCGTAA
SYNW0317 sufR -68 4.9 TTACGAAACGACCTGGTTTCCTTA
Thermosynechococcus elongatus BP-1
null sufB -116 5.5 TAAAACAACCGTTTTGTTGCTAAA
null sufB -78 5.2 TAAAGCAACCATCTCGTTGCTTAA
tlr0491 sufR -40 5.9 TTTAGCAACAAAACGGTTGTTTTA
tlr0491 sufR -78 5.7 TTAAGCAACGAGATGGTTGCTTTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD