Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IolR in Bacillales

Properties
Regulator family: DeoR
Regulation mode: repressor
Biological process: Inositol utilization
Effector: 2-deoxy-5-keto-D-gluconate 6-phosphate
Regulog: IolR - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus subtilis subsp. subtilis str. 168
BSU39760 iolA -196 6.4 TAACCAAGAAATGACCAAAAAG
BSU39770 iolR -69 -1.5 ACTATTGATTAACTTTTGGTTT
Bacillus amyloliquefaciens FZB42
RBAM_036780 iolA -224 6.5 TAACCAAGAAATGACCAAAACA
RBAM_036780 iolA -213 4.6 TGACCAAAACATAACCTGTAAA
RBAM_036790 iolR -69 -0.6 ACTATTGATTAACTTCTGGTGT
Bacillus licheniformis DSM 13
BLi04252 iolR -66 -1.7 ATTATTGGTTAACTTTTGGGTT
BLi04251 iolA -242 6.4 TAACCAAGAAGTGACCAAAACA
Bacillus clausii KSM-K16
ABC0422 iolA -66 5.9 TAACCAACAAATGATCAAAAAG
ABC0421 iolR -160 -2 CTTTTTGATCATTTGTTGGTTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD