Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FadR in Bacillales

Properties
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Palmitoyl-CoA; Oleoyl-CoA
Regulog: FadR - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus subtilis subsp. subtilis str. 168
BSU10270 lcfB -35 6.5 ATGAATGACTATTCATTCAC
BSU32840 fadN 39 6.7 ATGAATGACTATTCATTCAA
BSU37180 fadF -98 6.3 TTGACTGAACACTCATTCAT
BSU28550 fadR -44 6.9 ATGAATGAATAGTCATTCAT
BSU14060 ykuF -36 6.4 TTGAATGAATAATCATTCAC
Bacillus amyloliquefaciens FZB42
RBAM_013850 ykuF -40 6.8 ATGAATGATTATTCATTCAA
RBAM_010470 lcfB -44 6.9 ATGAATGACTATTCATTCAT
RBAM_029920 fadN -39 6.7 ATGAATGACTATTCATTCAA
RBAM_025610 fadR -38 6.9 ATGAATGAATAGTCATTCAT
RBAM_034330 fadF -82 6.3 TTGACTGAACACTCATTCAT
Bacillus pumilus SAFR-032
BPUM_1303 ykuF -40 6.7 ATGAATGAATAGTCATTCAA
BPUM_0969 lcfB -44 6.5 ATGAATGGTTATTCATTCAT
BPUM_3374 fadF -88 6.6 TTGACTGAATACTCATTCAT
BPUM_2942 fadN -39 6.5 ATGAATGACTGTTCATTCAA
BPUM_2512 fadR -41 6.8 ATGAATGAATACTCATTCAA
Bacillus licheniformis DSM 13
BLi01620 ykuF -36 6.8 TTGAATGAATACTCATTCAT
BLi01103 lcfB -39 6.3 ATGAATGGTCATTCATTCAT
BLi03466 fadN -39 6.8 ATGAATGAGTATTCATTCAA
BLi03002 fadR -43 6.9 ATGAATGAGTATTCATTCAT
BLi03969 fadF -82 6.3 TTGACTGAACACTCATTCAT
Anoxybacillus flavithermus WK1
Aflv_0565 fadR -44 6.9 ATGAATGATTATTCATTCAT
Aflv_2740 fadF -85 6.3 TTGACTGAATGCTCATTCAT
Aflv_2253 lcfB -41 6.3 ATGAATGATGATTCATTCAT
Aflv_1909 null -37 6.5 ATGAATGAATAACCATTCAT
Aflv_1606 Aflv_1606 -53 6.5 ATGAATGAATATTCATTCTT
Geobacillus kaustophilus HTA426
GK3008 fadN -40 6.5 ATGAATGACCATTCATTCAA
GK2689 fadR -60 6.1 ATGAATGATGGTTCATTCAT
GK3398 fadF -106 6.3 TTGACTGAATGCTCATTCAT
GK0668 lcfB -38 6.3 ATGAATGGTCATTCATTCAT
GK1044 null -34 6.5 ATGAATGAGTAATCAGTCAT
GK1401 Aflv_1606 -76 5.5 AAAAATGAATGATCATTCAT
Bacillus cereus ATCC 14579
BC5345 fadF -115 5.9 TTGACTGAATGCTCACTCAT
BC5004 fadN -38 6.5 TTGAATGAGCATTCATTCAA
BC4525 fadR -45 6.6 ATGAATGACTATTCATTCAG
BC3990 null -29 5.2 ATGAATGTGTATTCATTTTT
Bacillus halodurans C-125
BH3488 fadN -36 6.5 ATGAATGAGTATTCATTCGT
BH3102 fadR -38 6.9 ATGAATGAATACTCATTCAT
BH3802 fadF -123 6.5 ATGAGTGAATACTCATTCAT
BH2144 BH2144 -38 6.8 TTGAATGAATATTCATTCAA
Bacillus clausii KSM-K16
ABC2990 fadN -46 5.9 ATGAATGAGTGTTCATTCGG
ABC2672 fadR -45 6.8 ATGAATGAACATTCATTCAT
ABC3892 fadF -109 6.2 CTGACTGAATGCTCATTCAT
ABC0525 Aflv_1606 -38 6.4 GTGAATGATTACTCATTCAT
Oceanobacillus iheyensis HTE831
OB2395 fadN -41 6.6 ATGAATGAGCATTCATTCAA
OB2121 fadR -50 5.9 ATGAATGATCATTCACTCAG
OB3014 fadF -106 6.3 TTGACTGAATGATCATTCAT
OB1176 lcfB -41 6.9 ATGAATGAGTATTCATTCAT
OB0204 Aflv_1606 -73 6.6 ATGACTGATTATTCATTCAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD