Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator YiaJ in Enterobacteriales

Properties
Regulator family: IclR
Regulation mode: repressor
Biological process: L-lyxose utilization
Effector: Ascorbate-6-phosphate
Regulog: YiaJ - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Escherichia coli str. K-12 substr. MG1655
b3575 yiaK -70 6.4 ATTTGAAATCAAGTTTCGCAT
b3574 yiaJ -151 6.3 ATGCGAAACTTGATTTCAAAT
Salmonella typhimurium LT2
STM3667 yiaJ -168 6.2 ATGCGAAATCTAGTTCCAAAT
STM3668 yiaK -82 6 ATTTGGAACTAGATTTCGCAT
Citrobacter koseri ATCC BAA-895
CKO_05033 yiaK -72 6.5 ATTTGAAATCAGATTTCGCAT
CKO_05032 yiaJ -167 6.5 ATGCGAAATCTGATTTCAAAT
Serratia proteamaculans 568
Spro_3928 yiaJ -287 6.1 ATGCGAAATTCAATTTCAAAA
Spro_3933 yiaK -74 6.1 ATTTGAAATGCAATTCCGCAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD