Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator ZntR in Enterobacteriales

Properties
Regulator family: MerR
Regulation mode: activator
Biological process: Zinc resistance
Effector: Zinc ion, (Zn2+)
Regulog: ZntR - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Escherichia coli str. K-12 substr. MG1655
b3469 zntA -64 7.7 ACTCTGGAGTCGACTCCAGAGT
Salmonella typhimurium LT2
STM3576 zntA -67 7.7 ACTCTGGAGTCGACTCCAGAGT
Citrobacter koseri ATCC BAA-895
CKO_04898 zntA -67 7.7 ACTCTGGAGTCGACTCCAGAGT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
KPN_03835 zntA -67 7.7 ACTCTGGAGTCGACTCCAGAGT
Enterobacter sp. 638
Ent638_3873 zntA -66 7.7 ACTCTGGAGTCGACTCCAGAGT
Erwinia amylovora ATCC 49946
EAM_3299 zntA -76 6.9 ACTCTGGAGCTAACTCCAGAGT
Yersinia pestis KIM
y0410 zntA -135 7.1 ACTCTGGAGTTGGCTCCAAGGT
Serratia proteamaculans 568
Spro_0209 zntA -69 7.4 ACTCTGGAGTTGACTCCAGGGT
Edwardsiella tarda EIB202
ETAE_0137 zntA -71 7.3 ACTCTGGAGTCGACTCCAACGT
Proteus mirabilis HI4320
PMI3600 zntA -74 6.5 ACTCTGGACTCTACTCCAAGCT
Photorhabdus luminescens subsp. laumondii TTO1
plu4108 zntA -70 7.1 ACTCTGGAGTAGGCTCCAAAGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD