Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator EbgR in Enterobacteriales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactosides utilization
Effector: Beta-galactosides
Regulog: EbgR - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Escherichia coli str. K-12 substr. MG1655
b3076 ebgA -94 6.2 CTACTTTTTAGTAAAAATTTT
b3075 ebgR -201 5.7 TAAAATTTTACTAAACTATAG
Serratia proteamaculans 568
Spro_1971 ygjJ -160 6.4 GTATTTTTTACTAAATATTTT
Spro_1973 ebgA -59 6.2 GTGAATTTTACTAAATATTTA
Spro_1972 ebgR -223 5.9 AAAATATTTAGTAAAAAATAC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD