Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GltR in Bacillales

Properties
Regulator family: LysR
Regulation mode: repressor (activator)
Biological process: unknown
Effector:
Regulog: GltR - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus subtilis subsp. subtilis str. 168
BSU26670 gltR -37 5.8 GACATCTCAAAATCAGATATC
BSU26800 yrpB -241 5.8 GACATCTCAAAATCAGATATC
Paenibacillus sp. JDR-2
Pjdr2_3123 gltR -50 5.4 GATATCATTTTTTCAGATATT
Pjdr2_3122 yrpB -111 5.3 GCTATCTCTTTTCGGGATAGC
Pjdr2_3124 Pjdr2_3124 -101 5.4 AATATCTGAAAAAATGATATC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD