Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator KdgR in Enterobacteriales

Properties
Regulator family: IclR
Regulation mode: repressor (activator)
Biological process: Pectin and polygalacturonate utlization
Effector: 2-keto-3-deoxygluconate
Regulog: KdgR - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Escherichia coli str. K-12 substr. MG1655
b3526 kdgK -86 5.3 TAATGGAACACTGTTTTAATA
b1702 ppsA -222 5.3 TATGAAAACAGCATTTCATTT
b1703 ppsR -131 5.3 AAATGAAATGCTGTTTTCATA
b2843 kduI -63 5.4 AAACGAAACAGTGTTTCACTA
b2843 kduI -130 6.3 AAATGAAACATTGTTTTATTT
b3909 kdgT -140 6 AAATAAAACAGCGTTTCAATT
b3090 ygjV -64 5.4 ATAAAAAACGGCGTTTCATAA
b1676 pykF -286 5 TTTTGAAACGCTGTTTTTGTT
b1985 yeeO -7 4.9 ATTTGAAATGTGGTTTCACTT
b4252 yjgK -35 6 AAATGAAACGTTGTTTTAATT
b1850 eda -359 4.5 TATTGGACCGGTGTTTCAAAA
Salmonella typhimurium LT2
STM4054 rhiA -126 4.7 ATGTGAAACAGGGTTTCAAAA
STM1349 ppsA -226 4.9 AATGAAAAGTGTGTTTCATTT
STM1348 ppsR -131 4.9 AAATGAAACACACTTTTCATT
STM3018 kduI -58 5.3 AATCAAAACAGTGTTTTGATT
STM3018 kduI -123 6.2 AAATGAAACGTTGTTTTATTT
STM4395 kdgX -34 5.8 AAATAAAACATTATTTTAATT
STM3612 kdgK -85 4.9 TAATGGACCGATGTTTTAATA
STM1378 pykF -286 4.7 TTTTGAAACAGGGTTTTCATT
STM2013 yeeO -7 5 TATTGAAATGTGGTTTCAACT
STM4263 yjcB -120 5.4 AATAGAAACAATGTTTCATTC
STM4468 yjgK -32 5.7 AAATAAAACGCTGTTTTAACT
STM1884 eda -360 4.5 TATTGGACCGCCGTTTCAAAA
STM1931 tpfX -231 5.4 TTATGAAACATTGTTTCAGAT
Citrobacter koseri ATCC BAA-895
CKO_01709 pykF -286 5 TTTTGAAACGCTGTTTTCATT
CKO_04968 kdgK -87 5.3 TAATGGAACGATGTTTTAATA
CKO_01725 ppsA -249 5.5 AAATGAAACGCTATTTTTATA
CKO_01727 ppsR -107 5.5 TATAAAAATAGCGTTTCATTT
CKO_04220 kduI -51 4.4 AAACGGAACGGTGTTTCGCCT
CKO_04220 kduI -119 6.2 AAATGAAACAACGTTTTATTT
CKO_01081 rhiT -190 5.4 AATAGAAACGCTGTTTTATAA
CKO_03627 kdgX -31 5.2 AAATAAAACATTATTTCAAAG
CKO_04218 kdgF -38 5.6 AGTTGAAACATTGTTTCAATA
CKO_01753 kduD2 -99 5.9 TTATAAAACACTGTTTCATTT
CKO_03092 kdgT -147 5.6 AAATGAAACATAGTTTTGTTA
CKO_00837 yeeO -7 4.9 ATTTGAAATGAGGTTTCAACT
CKO_04899 rhiA -138 5.1 TTTTAAACCATCGTTTCAATT
CKO_04899 rhiA -50 4.8 AACTAAAACAATGTTTTAACG
CKO_03830 yjcB -121 5.1 AACAGAAACGTTGTTTCATTC
CKO_03757 kdgT -231 5.7 AACTAAAACAGTGTTTTATTT
CKO_03553 yjgK -33 6.2 AAATGAAACGTTGTTTTATTT
CKO_01049 tpfX -199 5.4 TTTTGAAATGATGTTTCATAT
CKO_01116 eda -360 4.5 TATTGGACCGTTGTTTCAAAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
KPN_02133 pykF -285 5 ATTTGAAACGAGGTTTTTATT
KPN_03876 kdgK -87 5.3 TAATGGAACGATGTTTTAATA
KPN_02160 ppsA -254 5.1 AATTGAAACGCTATTTTTGTT
KPN_02161 ppsR -97 5.1 AACAAAAATAGCGTTTCAATT
KPN_03265 kduD -139 5.2 AAACGGAACTCTGTTTTATTT
KPN_03265 kduD -207 5.8 AAATGAAACATCGTTTTAAAT
KPN_03266 ogl -299 5.8 ATTTAAAACGATGTTTCATTT
KPN_03256 togM -211 5.6 AATTAAAACGGTGTTTTATAA
KPN_03256 togM -288 5 TTTTGAAACATCGTTTCGACT
KPN_02390 rhiT -200 4.9 AAGAGAAATGCTGTTTTATAA
KPN_03255 kdgF -39 5.8 AAATGAAACAATGTTTCACTT
KPN_04658 yjgK -33 5.8 AAATGAAATGCTGTTTTATAT
KPN_01240 kduD2 -104 5.8 AATCAAAACATTGTTTCATTT
KPN_03267 kdgM -37 5.6 AAACGAAATGTCATTTTATTT
KPN_03267 kdgM -58 5.8 AAATAAAATGATGTTTCATAA
KPN_02398 togT -46 5.2 TATAAAAACAGTGTTTCAAAA
KPN_03266 ogl -103 5.6 TAATGAAACAATGTTTTGATA
KPN_02343 kdgR -161 5 AAATGAAACGGTTTTTTGAAT
KPN_02447 yeeO -40 5.1 ATTTGAAATGTTGTTTCAACA
KPN_04460 yjcB -113 4.9 AACAGAAATGGCGTTTCATCA
KPN_02365 eda -361 4.5 TATTGGACCGCCGTTTCAAAA
KPN_02601 setC -102 5 TTTTGAAACGCCTTTTTAATT
Enterobacter sp. 638
Ent638_1768 pykF -286 5.1 TTTTGAAACGCCGTTTCCATT
Ent638_1745 ppsA -249 5.3 AAATGAAATGGTGTTTTTAAT
Ent638_1744 ppsR -107 5.3 ATTAAAAACACCATTTCATTT
Ent638_3296 kduI -60 5 AATCGGAACATTGTTTCGTTA
Ent638_3296 kduI -127 5.4 AACTGAAACAACGTTTTAAAT
Ent638_3297 ogl -105 5 CATTGAAACGTCGTTTTGATA
Ent638_3289 togM -226 5.1 AATTAAAACGCCGTTTTACAA
Ent638_2444 rhiT -189 5.6 AAAAGAAACGCTGTTTTATAA
Ent638_0375 kdgX -33 5.9 AATTGAAACGTCATTTTATTT
Ent638_3287 kdgF -38 5.5 AATTAAAACAATGTTTCACTA
Ent638_3298 kdgM -33 5.4 AAACGAAATGACATTTTAATT
Ent638_3298 kdgM -54 4.9 AAATAAAATGCAGTTCCATAA
Ent638_0453 yjgK -34 6 AAATGAAACATTGTTTTATAT
Ent638_1716 kduD2 -94 5.6 TTTTAAAACATCATTTCATTT
Ent638_3923 kdgK -84 5.1 TTATGGAACGACGTTTTAATA
Ent638_2574 yeeO -74 5 ATTTGAAATGTAGTTTCAACT
Ent638_3876 rhiA -134 4.5 TTTCAAACCATCGTTTCAAAA
Ent638_3876 rhiA -49 4.8 AACTAAAACAACGTTTTAACG
Ent638_0314 kdgT -232 5.8 AACTAAAACATTGTTTTATTT
Ent638_4134 pelX -60 5.7 AAAAGAAACGACGTTTCATCT
Ent638_4134 pelX -102 5.2 AAGCAAAACAACGTTTTAATT
Ent638_2764 setC -109 4.9 TTTTGAAATGCTATTTTGATT
Ent638_2477 tpfX -42 5 GGATGAAACGCTGTTTTAAAT
Ent638_0483 kdgM -304 4.9 TCTCAAAACATCATTTCATTT
Ent638_2419 eda -362 4.5 TATTGGACCGCTGTTTCAAAA
Yersinia pestis KIM
y3757 pemA -149 5.3 AAATGGAATTGCGTTTCATTT
y1880 kdgM -103 5.4 AAATGAAACATTGCTTCTTTT
y1887 kduI -201 6 TAATAAAACATCATTTCATTT
y1875 ogl -96 5.8 AAATGAAACATTGTTTCTATA
y1885 pelW -76 5.2 GATTGAAACGATGTTTCTATT
y1885 pelW -152 4.5 AATCAAAACAACGTTCCGACT
y1734 kdgX -22 5.8 TAACGAAACATCATTTCATTT
y3838 kdgK -225 5.1 ATTTAAAACACCGTTTTAATC
y1888 kdgF -155 6 AAATGAAATGATGTTTTATTA
y0739 yjgK -41 5.9 TAATAAAACAGCATTTCATTT
y3597 ygjV -133 5.2 ATATGAAACGGTGTTCTGTTT
y2961 togT -25 6.1 AAATGAAACATTGTTTTAATT
y2961 togT -47 4.5 AAAGAAAACAGTTATTCATTA
y2593 yeeO -158 4.8 TCATGAAACTATGTTCCATTT
y1876 kdgR -76 4.7 AATAAAACCATTGTTCTATTT
y3833 kdgM -75 5.7 AAATAAAATACTGTTTCATAA
Serratia proteamaculans 568
Spro_2173 ppsR -134 5.2 ATTTGAAATAGTGTTTTACTT
Spro_4750 kdgK -105 6.2 AAATAAAACGTTGTTTTATTT
Spro_3106 yeeO -39 5.2 ATTTGAAATGTTGTTTCACTT
Spro_2174 ppsA -364 5.2 AAgTaAAACAcTaTTTCAaaT
Spro_2187 pykF -203 4.1 AAtaacAACAcatTTTCATcT
Erwinia carotovora subsp. atroseptica SCRI1043
ECA2730 setC -88 5 TAATGAAACAAGATTTCTGTT
ECA1095 pehA -152 3.9 TATGTAAATGGACTTTTATTA
ECA4123 rexZ -66 4.4 AAATAAATTACCGTTGCGTTA
ECA1867 pykF -259 5.1 ATACGGAACGTCGTTTCAATT
ECA1742 spiX -54 5.1 AATTGAAATACAGTTTTAAAA
ECA3252 paeY -213 5.1 TATTAAAATAACATTTCACTT
ECA1853 ppsA -227 5.6 TATTAAAACGCCATTTCATTA
ECA1852 ppsR -94 5.6 TAATGAAATGGCGTTTTAATA
ECA2400 kduI -209 6.1 AAATAAAACATTATTTCATTT
ECA3902 null -172 4.5 TATTGAAACGTGATTTCTATC
ECA4070 pelZ -2 4.1 AAATGAAACGTTCTCTTCTGT
ECA4067 pelC -77 4.1 TGTTGAAACAGCCATTTTATT
ECA4067 pelC -99 4.5 AGACAAACCTTAATTTCATTT
ECA2730 sotA -88 5 TAATGAAACAAGATTTCTGTT
ECA4123 rexZ -138 5.9 TAATAAAACTATGTTTCATTT
ECA2426 ogl -180 5.8 AAATGAAACATTGTTTCTATA
ECA2402 pelW -61 5.3 AATCAAAACAGTGTTTCTATT
ECA3560 rhiT -167 4.7 AGTTAAAATGCCTTTTTATAA
ECA2402 pelW -139 4.5 AATCAAAACAACGTTCCGACT
ECA2399 kdgF -174 6.1 AAATGAAATAATGTTTTATTT
ECA4360 kdgK -125 5.4 AAATAAAACATCGTTTCAAGA
ECA0383 yjgK -41 5.1 TTGTAAAACAGGGTTTCATTT
ECA1095 pehA -65 3.9 AAAGGAAGCGTAATTCCTTTT
ECA1095 pehA -100 4.3 TTCTATAAAAGTGTTTTATTT
ECA0357 rhiA -239 5.6 ATATAAAACAGCATTTCATAT
ECA0817 togT -38 5.5 AACTGAAATATTGTTTCATAT
ECA0648 ygjV -70 6.2 AAATAAAACGGCGTTTCATTT
ECA0817 togT -60 4.5 TAAAGAAATGATAGTTCAATC
ECA0732 sghX -76 4 TATCACAATAAGGTTCCATTT
ECA0732 sghX -98 5.6 AAATAAAACCTCGTTTCTTTT
ECA2762 yeeO -140 5.1 AATAGAAACGTCATTTTAAAA
ECA1190 pehN -37 5.7 TATTAAAACGATATTTCATTA
ECA4069 pelC -102 4.5 CAATAAACCTTGATTTCATTT
ECA4069 pelC -289 5.4 AAACGAAATATAATTTTATTT
ECA3112 pelF -291 4.9 TAATGAAACCATGTTTTACCA
ECA4067 pelC -231 4.2 AAATAGAAATCAGTTTCTATT
ECA4510 pelX -66 6 AAAAGAAACAGCGTTTCATTT
ECA2407 kdgM -153 4.8 ATTTGAAACCCTATTTTACTT
ECA4510 pelX -113 4.2 ATAAAAAACAGACTTTATTTT
ECA4510 pelX -130 5.3 AAATGACACGGTGTTTCATAA
ECA2137 ECA2137 -349 5.2 AAATGAAACAATGCTTCCTTT
ECA0102 tpfX -85 6.1 TAATAAAACATCGTTTCATTT
ECA3785 dhfX -32 5.9 AAAAGAAACGATGTTTTATTT
Edwardsiella tarda EIB202
ETAE_1898 kduI -129 5.6 AATCAAAACAGCATTTCATTT
ETAE_3377 kdgK -91 5.4 AAACAGAACGTTGTTTTATTT
ETAE_3112 yjgK -39 5.6 AAATAAAACGCAGTTTTATAA
ETAE_1567 kdgR -46 4.8 TACTGAAACAGAGGTTCGTTT
ETAE_2529 aslB -70 5.3 ATAAGAAACATCGTTTTAAAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD