Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CcpN in Bacillales

Properties
Regulator family: CcpN
Regulation mode: repressor
Biological process: Gluconeogenesis
Effector:
Regulog: CcpN - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus subtilis subsp. subtilis str. 168
BSU30560 pckA -61 5.1 AATATATGTTATACTAATTCA
BSU29020 gapB -67 5.5 TTAATGTGTTATACTAATTTT
Bacillus amyloliquefaciens FZB42
RBAM_027580 pckA -63 4.7 GATATATGTTATACTAATTCC
RBAM_026060 gapB -68 5.1 TTAATGTGTTATACTATATAT
Bacillus pumilus SAFR-032
BPUM_2687 pckA -58 4.6 TGAATGTGTTATACTAATCGA
BPUM_2547 gapB -69 4.4 CTAATGTGATATACTAATTTC
BPUM_2547 gapB -38 5.1 TTATTGAGTATAACACATAAT
Bacillus licheniformis DSM 13
BLi03052 gapB -68 5.4 ATAATGTGTTATACTTATTTT
BLi03197 pckA -67 5.4 TAAATGTGTTATACTAATTCT
BLi03197 pckA -45 4.3 CATTAATGTTATACACATTAA
Anoxybacillus flavithermus WK1
Aflv_0514 gapB -38 5.2 ATAAATAGTATAACACATATA
Aflv_0514 gapB -70 5 TAAAAATGTTATACTATTTTT
Aflv_0413 pckA 28 5 AAAATGTGTTATACTTTTTAC
Geobacillus kaustophilus HTA426
GK2726 gapB -69 4.8 AAAATATGATATACTATTTAT
GK2726 gapB -38 4.4 GAAAATAGTATAACATATATG
GK2850 pckA -55 5.2 AAAATGTGTTATACTATTTTC
Bacillus cereus ATCC 14579
BC4762 pckA -69 4.8 TAATTGTGTTATACTCTTGTT
BC4583 gapB -37 4.7 ATAAATAGTATAACGCATTCA
BC4583 gapB -68 4.8 TTTTTGTGTTATACTATTATT
Bacillus halodurans C-125
BH3302 pckA -60 5.3 TAAATGTGTTATACTAAATAA
BH3149 gapB -66 4.8 TAAAAGTGATATACTATTTAT
Bacillus clausii KSM-K16
ABC2879 pckA -51 4.6 AAAATGTGTTATACTAAAGCC
ABC2705 gapB -71 4.7 TATTTATGTTATACTATTTCA
Oceanobacillus iheyensis HTE831
OB2315 pckA -88 5.3 TTAATGTGTTATACTAATAAT
OB2160 gapB -36 4.4 GTTATGAGTATATCATAATTA
OB2160 gapB -66 5.2 AATTTGTGTTATACTAATTAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD