Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AcoR in Bacillales

Properties
Regulator family: Fis
Regulation mode: activator
Biological process: Acetoin utilization
Effector: Acetoin
Regulog: AcoR - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus subtilis subsp. subtilis str. 168
BSU08060 acoA -129 8 GACAAAACGAGACACACGTCTCAAACTGTCTC
Bacillus amyloliquefaciens FZB42
RBAM_008300 acoA -129 8.1 GACAAAATGAGACACCTGTCTCAAACTGTCTC
Bacillus pumilus SAFR-032
BPUM_0451 acoA -140 7.7 GACAAATAGAGATTCAAGTCTCATTTTGTCTC
Bacillus licheniformis DSM 13
BLi00849 acoA -140 8 GACAAATTGAGACATCTGTCTCGTTTTGTCTC
Bacillus cereus ATCC 14579
BC2779 acoA -135 7.8 GACAAAACGAGACAAATGTCTCATTTTGTCCA
Bacillus halodurans C-125
BH1822 acoA -141 5.7 GACAATGTGAGACGTAACAGTGTTGCTAGTTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD