Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator PhhR in Pseudomonadaceae

Properties
Regulator family: TyrR
Regulation mode: activator (repressor)
Biological process: Aromatic amino acid metabolism
Effector: Tyrosine; Phenylalanine
Regulog: PhhR - Pseudomonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Pseudomonas aeruginosa PAO1
PA0865 hpd -161 4.4 GCGTAAGGAATAGTTGCCAG
PA0865 hpd -212 5.6 CTGTAAAGATAACTTTACGA
PA0872 phhA -217 5.2 CCGTCAAGAATATGTGACAG
PA0872 phhA -144 5.5 TCGTAAGGAAAACTTTACGA
PA0873 phhR -159 5.5 TCGTAAAGTTTTCCTTACGA
PA0873 phhR -86 5.2 CTGTCACATATTCTTGACGG
Pseudomonas entomophila L48
PSEEN3892 phhA -210 5.2 TCGTAAAGATAAGCTGACAA
PSEEN3892 phhA -137 5.4 TTGTAAAATTATCGTTACAA
PSEEN3891 phhR -138 5.4 TTGTAACGATAATTTTACAA
PSEEN3891 phhR -65 5.2 TTGTCAGCTTATCTTTACGA
Pseudomonas fluorescens Pf-5
PFL_1612 phhR -194 5.5 TTGTAAAGTAAACGTTACGA
PFL_1612 phhR -120 5.3 CTGTCACATAATCTTGACGA
PFL_1611 phhA -207 5.3 TCGTCAAGATTATGTGACAG
PFL_1611 phhA -133 5.5 TCGTAACGTTTACTTTACAA
Pseudomonas mendocina ymp
Pmen_1696 hpd -144 4.9 CTGTAAGAAAAACTTGCCAA
Pmen_1696 hpd -195 4.7 CTGGCAAGAAAACCTTACGC
Pmen_3112 phhA -193 5.2 CCGTCAAGAATATGTGACAG
Pmen_3111 phhR -80 5.2 CTGTCACATATTCTTGACGG
Pseudomonas putida KT2440
PP4490 phhA -212 5.2 TCGTAAAGATAAGCTGACAA
PP4490 phhA -139 5.4 TTGTAAAATTATCGTTACGA
PP4489 phhR -138 5.4 TCGTAACGATAATTTTACAA
PP4489 phhR -65 5.2 TTGTCAGCTTATCTTTACGA
Pseudomonas stutzeri A1501
PST_0869 hpd -143 5.2 CTGTAAGGAAAACCTGACAG
PST_0869 hpd -203 4.8 CTGTCAGCTTTTCGTTACGC
PST_3561 phhR -136 4.9 CTGTAAGAAATACATGACAG
PST_3561 phhR -74 5.4 CTGTCAAATAATCTTGACGA
PST_3562 phhA -191 5.4 TCGTCAAGATTATTTGACAG
PST_3562 phhA -129 4.9 CTGTCATGTATTTCTTACAG
Pseudomonas syringae pv. tomato str. DC3000
PSPTO1823 phhR -88 4.9 GTGTAACGTATTGTTGACGG
PSPTO1823 phhR -161 5.5 TCGTAACGAAAACTTTACGA
PSPTO1822 phhA -206 4.9 CCGTCAACAATACGTTACAC
PSPTO1822 phhA -133 5.5 TCGTAAAGTTTTCGTTACGA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD