Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CzrA in Bacillales

Properties
Regulator family: ArsR
Regulation mode: repressor
Biological process: Zinc resistance; Nickel resistance; Copper resistance; Cobalt resistance; Cadmium resistance
Effector: Zinc ion, (Zn2+); Silver ion, (Ag+); Nickel ion, (Ni2+); Copper ion, (Cu2+); Cobalt ion, (Co2+); Cadmium, ion (Cd2+)
Regulog: CzrA - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus subtilis subsp. subtilis str. 168
BSU26650 czcD -116 7.1 TATATGAACACATGCTCATATA
BSU33490 cadA -94 7.3 TATATGAGTATATGCTCATATA
Bacillus amyloliquefaciens FZB42
RBAM_005600 czcD -106 6.9 TATATGAGCACATAATCATATA
RBAM_030670 czcD -87 7.3 TATATGAGTATATGTTCATATA
Bacillus pumilus SAFR-032
BPUM_3010 cadA -87 7.3 TATATGAATATATGCTCATATA
Bacillus licheniformis DSM 13
BLi03452 czcD -45 6.6 AATATGAATACATGATCATATA
BLi03539 cadA -61 6.9 TATATGCGTATATGCTCATATA
Anoxybacillus flavithermus WK1
Aflv_1335 czrA -41 7.2 TATATGAACATATATTCATATA
Geobacillus kaustophilus HTA426
GK0580 czrA -48 7 CATATGAACATATGCTCATATA
GK1406 czrA -43 7.1 TATATGAACAAATGCTCATATA
Bacillus cereus ATCC 14579
BC3447 czcO -44 6 TATATGAACAAATATTCATACG
BC0595 czrA -46 5.7 TATATGAatgatTGtTCATATg
Bacillus clausii KSM-K16
ABC3390 czrA -36 6.8 AATATGAACATATAATCATATA
Oceanobacillus iheyensis HTE831
OB1400 czrA -39 6.7 AATATGAGCATATGATCATATT
Paenibacillus sp. JDR-2
Pjdr2_1130 cadA -41 6.7 TATATGAGCAAGTATTCATATA
Pjdr2_0376 czcD -44 6.1 CATATGAATAGTTGTTCATATA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD