Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AseR in Bacillales

Properties
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector: Arsenite
Regulog: AseR - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus subtilis subsp. subtilis str. 168
BSU05330 aseR -191 6.3 TATATAAATAAAAGTTTATATA
BSU05330 aseR -46 6.8 TATATAACGATTTGCTTATATA
Bacillus amyloliquefaciens FZB42
RBAM_035850 aseR -46 6.9 TATATAAACATCTGCTTATATA
Bacillus licheniformis DSM 13
BLi02123 aseA -79 6.6 AATATAAGCATTGACTTATATA
Anoxybacillus flavithermus WK1
Aflv_1412 aseR -50 6.8 CATATAAGTATATGATTATATA
Geobacillus kaustophilus HTA426
GK3224 aseR -124 6.8 TATATAAGTACTTAATTATATA
GK3224 aseR -42 5.9 TATATAAGCAAATCATGATATG
GK0587 aseR -212 6.9 TATATAAGTATGTAGTTATATA
GK0587 aseR -48 6.5 TATATAAGTAAATAACTATATA
Bacillus halodurans C-125
BH3000 aseR -55 7.2 TATATAAGTATATGTTTATATA
Bacillus clausii KSM-K16
ABC0835 aseR -66 6.9 TATATTAGCATTTACTTATATA
Oceanobacillus iheyensis HTE831
OB2425 aseR -60 6 AACATAAGCATTGACTTATATA
OB2425 aseR -44 7.4 TATATAAGCAAATGCTTATATA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD