Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator LexA in Enterobacteriales

Properties
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Regulog: LexA - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Escherichia coli str. K-12 substr. MG1655
b3813 uvrD -76 4.9 ATCTGTATATATACCCAGCT
b2699 recA -79 5.7 TACTGTATGAGCATACAGTA
b0958 sulA -42 5.6 TACTGTACATCCATACAGTA
b0231 dinB -34 4.8 CACTGTATACTTTACCAGTG
b4043 lexA -47 5.1 TGCTGTATATACTCACAGCA
b4043 lexA -26 5.2 AACTGTATATACACCCAGGG
b0890 ftsK -96 5 TCCTGTTAATCCATACAGCA
b1728 ydjM -52 4.4 CACTGTATAAAAATCCTATA
b1728 ydjM -34 4.7 TACTGTACGTATCGACAGTT
b2616 recN -68 5.7 TACTGTATATAAAACCAGTT
b2616 recN -46 4.9 TACTGTACACAATAACAGTA
b2616 recN -28 4.7 TAATGGTTTTTCATACAGGA
b0779 uvrB -94 5.6 AACTGTTTTTTTATCCAGTA
b1061 dinI -39 5.6 ACCTGTATAAATAACCAGTA
b1861 ruvA -69 5 CGCTGGATATCTATCCAGCA
b1848 yebG -37 5.3 TACTGTATAAAATCACAGTT
b4059 ssb -170 5.5 ACCTGAATGAATATACAGTA
b0799 dinG -34 4.9 TATTGGCTGTTTATACAGTA
b1741 cho -33 5.1 CACTGGATAGATAACCAGCA
b3068 ygjF -69 4.9 TGCTGTTTTTATAAACAATG
b4618 tisB -254 6.1 TACTGTTTATTTATACAGTA
b3645 dinD -63 5.9 AACTGTATATAAATACAGTT
b4613 dinQ -188 4.3 TGCTGGTTTTATAACCTGCA
b4613 dinQ -166 5.7 TACTGTATGATTATCCAGTT
b4347 yjiW -95 5 TACTGATGATATATACAGGT
b4058 uvrA -103 5.5 TACTGTATATTCATTCAGGT
b0060 polB -73 4.3 GACTGTATAAAACCACAGCC
b0685 ybfE -136 4.5 AACTGATTAAAAACCCAGCG
b1183 umuD -39 6.1 TACTGTATATAAAAACAGTA
b2009 sbmC -34 6.1 TACTGTATATAAAAACAGTA
b0221 yafH -73 4.3 AAATGTTTTTACATCCACTA
Salmonella typhimurium LT2
STM0097 polB -73 4.6 gcCTGTAcAaAataACAGTA
STM3951 uvrD -125 4.8 TTCTGTATAAATTCCCAGTT
STM2829 recA -84 5.7 TACTGTATGAGCATACAGTA
STM1071 sulA -41 6.2 TACTGTATGAATATACAGTA
STM0313 dinB -35 5.4 TACTGTACACTTAAACAGTA
STM4237 lexA -47 5.2 AACTGTATATACTCACAGCA
STM4237 lexA -26 4.4 GATTGTATATACACCCAGGG
STM0960 ftsK -96 5 TCCTGTTAATCCATACAGCA
STM1321 ydjM -52 4.4 TACTGTATAAAAACCCTATA
STM1321 ydjM -34 5.2 TACTGTATGAATTGACAGTT
STM2684 recN -68 5.6 TACTGTATAAAAAACCAGTT
STM2684 recN -46 5.3 TACTGTATTTAATTACAGTC
STM2684 recN -28 4.5 TCATGGTTTTTCATACAGGA
STM0798 uvrB -93 5.6 TACTGTTTTTTCATCCAGTA
STM1162 dinI -39 6.1 AACTGTATATATATCCAGTA
STM1895 ruvA -71 4.8 ATCTGGATAAACATCCAGTC
STM1882 yebG -37 5.5 TACTGTATATAAACACAGGT
STM4256 ssb -167 5.7 ACCTGTTTGAATATACAGTA
STM0821 dinG -34 4.8 TAGTGGCTGTTTATACAGTA
STM1309 cho -6 5.5 TACTGGATGAATAACCAGTT
STM3212 mug -70 4.9 TGCTGTTTTTATAAACAATG
STM1056 dinI -35 6 TACTGTATATACAAACAGTT
STM2621 dinI -39 5.7 TACTGTGTTTATATACAGTG
STM1019 dinI -39 5.7 TACTGTGTTTATATACAGTG
PSLT055 samA -37 5.2 TGCTGTATATAAAAACAGGC
STM4523 yjiW -94 4.4 TACTGATGTTATGTACAGGT
STM4254 uvrA -100 5.7 TACTGTATATTCAAACAGGT
STM1998 umuD -35 6.1 TACTGTATATAAAAACAGTA
STM2061 sbmC -41 5.5 TACTGTACATTCATACAGCA
STM0309 yafH -197 3.8 TACCGGATAGCAGTACAGGC
STM3969 rmuC -64 5.2 AACTGGACGTTTATACAGCA
Citrobacter koseri ATCC BAA-895
CKO_01890 dinI -25 6.1 TACTGTATAaAaATACAGTA
CKO_00155 uvrD -76 5 TATTGTATATATACCCAGCT
CKO_04050 recA -96 5.5 TACTGTATGACTGTACAGTA
CKO_02110 sulA -41 6 TACTGTATATCCATACAGTA
CKO_02960 dinB -35 5.8 TACTGTATACTTAAACAGTA
CKO_03872 lexA -47 5 AGCTGTATATACTCACAGCA
CKO_03872 lexA -26 5.2 AACTGTATATACACCCAGGG
CKO_02181 ftsK -39 5 TCCTGTTAATCCATACAGCA
CKO_01754 ydjM -52 4.4 TACTGTATAAAAACCCTATA
CKO_01754 ydjM -34 5.2 TACTGTATGAATTGACAGTT
CKO_03938 recN -68 5.6 TACTGTATAAAAAACCAGTT
CKO_03938 recN -46 5.1 TACTGTATGTAATCACAGTC
CKO_03938 recN -28 4.5 TCATGGTTTTTCATACAGGA
CKO_02348 uvrB -93 5.4 CACTGTTTTTTCATCCAGTA
CKO_02002 dinI -39 5.9 AACTGTATAAATACACAGTA
CKO_01099 ruvA -70 4.6 GGCTGGATATCTATCCAGCC
CKO_01118 yebG -38 4.8 TGCTGTACATAATTACAGGT
CKO_03842 ssb -168 5.3 ACCTGAATGGATATACAGTA
CKO_02329 dinG -34 4.8 TAGTGGCTGTTTATACAGTA
CKO_04467 null -70 4.7 TGCTGTTTTTATAAACAACG
CKO_03843 uvrA -102 5.3 TACTGTATATCCATTCAGGT
CKO_03322 polB -73 4.7 ACCTGTATAAAACCACAGCA
CKO_01842 umuD -38 5.9 TACTGTATATATAATCAGTA
CKO_00775 sbmC -157 5.7 TGCTGTGTTTATATACAGTA
CKO_00174 rmuC -60 5.2 AACTGGACGTTTATACAGCA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
KPN_04312 uvrD -53 4.6 CTCTGTATATATTAACAGGG
KPN_03031 recA -90 5.8 TACTGTATGACCATACAGTA
KPN_00987 sulA -39 6 TACTGTATATGCATACAGTA
KPN_00247 dinB 1 5.2 TGCTGTATGGGTATACAGTG
KPN_04431 lexA -47 5 AGCTGTATATACTCACAGCA
KPN_04431 lexA -26 5.2 AACTGTATATACACCCAGGG
KPN_00922 ftsK -97 5 TCCTGTTAATCCATACAGCA
KPN_01239 ydjM -34 5 TACTGTATGAATCGACAGTT
KPN_02938 recN -68 5.2 TACTGGATAAAAAACCAGTC
KPN_02938 recN -46 5.2 TACTGTACGAAAACACAGTA
KPN_02938 recN -28 4.9 TATTGGTTTTTCATACAGGA
KPN_00804 uvrB -95 5.7 CACTGTTTAAATATCCAGTA
KPN_01073 dinI -39 5.9 TACTGTATAAATAACCAGTA
KPN_02376 ruvA -69 4.6 GGCTGGATATCTATCCAGCC
KPN_02363 yebG -35 5.9 TACTGTATAAAAATACAGTG
KPN_04446 ssb -166 5.5 ACCTGAATGAATATACAGTA
KPN_00831 dinG -33 4.8 TAGTGGCTGTTTATACAGTA
KPN_01227 cho -32 5.3 TACTGGATGGATAGACAGTA
KPN_03475 ygjF -69 4.9 TGCTGTTTTTATAAACAATG
KPN_pKPN5p08226 impA -44 5.6 TACTGTATGCATAACCAGTA
KPN_04445 uvrA -105 5.5 TACTGTATATTCATTCAGGT
KPN_00059 polB -75 4.2 ACCTGTATAAAACCCCAGCG
KPN_01438 umuD -40 5.8 TACTGTATATAAAAACAGTG
KPN_02467 sbmC -42 5.8 AGCTGTATATTCATACAGTA
KPN_04328 rmuC -60 4.7 AACTGGACGTTTGTACAGCA
Enterobacter sp. 638
Ent638_3979 uvrD -68 5.1 TATTGTATAAATCAACAGTA
Ent638_3174 recA -92 5.9 TACTGTATGACTATACAGTA
Ent638_1470 sulA -34 6.2 TACTGTATATTCATACAGTA
Ent638_0762 dinB -37 5.8 TACTGTATACTTATCCAGTA
Ent638_0247 lexA -47 5 GACTGTATATACTCACAGCA
Ent638_0247 lexA -26 5.2 AACTGTATATACACCCAGGG
Ent638_1414 ftsK -96 5 TCCTGTTAATCCATACAGCA
Ent638_1715 ydjM -34 5.2 TACTGTATGAATTGACAGTT
Ent638_3096 recN -68 5.6 TACTGTATAAAAAACCAGTT
Ent638_3096 recN -46 5.8 TACTGTATAGAAATACAGTT
Ent638_1271 uvrB -95 5.4 CACTGGATTTACATCCAGTA
Ent638_1575 dinI -39 5.8 GACTGTATAAATAAACAGTA
Ent638_2430 ruvA -69 4.6 GGCTGGATAAACATCCAGCC
Ent638_1887 yebG -33 5.3 CACTGTATATAATTACAGTG
Ent638_0262 ssb -165 5.7 ACCTGTTTGAATATACAGTA
Ent638_1289 dinG -34 4.8 TAGTGGCTGTTTATACAGTA
Ent638_1703 cho -33 5 CACTGTATAGCTGAACAGTA
Ent638_3474 null -70 4.9 TGCTGTTTTTATAAACAATG
Ent638_1656 dinI -32 5.7 TGCTGTATATAAAAACAGTT
Ent638_2256 dinI -38 5.5 CACTGTATAAATGTACAGTT
Ent638_0261 uvrA -100 5.7 TACTGTATATTCAAACAGGT
Ent638_0607 polB 30 4.6 ACCTGTATAAAATCCCAGCA
Ent638_2213 umuD -34 5.9 TACTGTATGTAAAAACAGTA
Ent638_2577 sbmC -35 5.3 TAGTGTATAAATACACAGTA
Ent638_3961 rmuC -63 5.2 AACTGGACGTTTATACAGCA
Erwinia amylovora ATCC 49946
EAM_0308 ssb -171 4.5 GCCTGAATGGATAACCAGTG
EAM_0187 uvrD -55 5 ACCTGGTTATTTAACCAGTG
EAM_2640 recA -88 6.1 TACTGTATGATTATACAGTA
EAM_1378 sulA -40 5.7 TACTGTATATCCATACAGTC
EAM_0894 dinB -36 5.4 GACTGTATACTTATCCAGTA
EAM_0264 lexA -46 4.9 ACCTGTATATACTCACAGTC
EAM_0264 lexA -26 5 GACTGTATAAACAACCAGGG
EAM_1329 ftsK -80 4.9 TCCTGTGAATTCATACAGGT
EAM_1619 ydjM -56 4.3 TACTGTATATATTCCCTATA
EAM_1619 ydjM -38 4.8 TACTGGATGCATTGACAGTT
EAM_2529 recN -68 5.7 TACTGTTTATAAAACCAGTA
EAM_2529 recN -46 4.3 TACTGTATGAAAAACCATAT
EAM_2529 recN -28 4.8 ATCTGTGTTTTCATACAGGA
EAM_1216 uvrB -96 4.7 AGCTGTGATTATATCCAGTG
EAM_1429 dinI -38 5.8 AACTGTATATATTTACAGTT
EAM_2004 ruvA -68 5 AGCTGGATATCTATCCAGCT
EAM_1993 yebG -35 5.7 TACTGTATAAAAACACAGTT
EAM_1250 dinG -43 4.8 TACTGTGCAAAAATACAGCC
EAM_1613 cho -33 5.3 TACTGTTCGGATAAACAGTA
EAM_P216 samA -35 6 TACTGTATATGCATACAGTA
EAM_0307 uvrA -101 4.5 CACTGGTTATCCATTCAGGC
EAM_0673 polB -53 4.9 TACTGTATAAATAAACATGC
EAM_0201 rmuC -64 4.5 GTCTGGACATTTATACAGTG
Yersinia pestis KIM
y0389 uvrD -82 4.7 CCCTGTGTAAATCTACAGTG
y0881 recA -102 5.6 TACTGTATGATTGTACAGTA
y2734 sulA -39 6.1 TACTGTATATACATACAGCA
y0959 dinB -41 5.3 GACTGTATACTTATACAGCT
y0572 lexA -47 5 AGCTGTATATACTCACAGCA
y0572 lexA -26 5.4 AACTGTATAAACAAACAGGG
y2800 ftsK -86 5.7 TCCTGTTTATTCATACAGTT
y1879 ydjM -39 5 TACTGGATAAATCAACAGCT
y3026 uvrB -97 5.3 AGCTGGTTTTATATCCAGTA
y1747 dinI -41 6.1 TACTGTATAAATAAACAGTA
y2253 ruvA -244 4.4 GGCTGGATATCCATCCAGCC
y2530 yebG -47 5.2 CACTGTGATTATATACAGTT
y0582 ssb -158 4.8 ACCTGAATGGATATCCAGTG
y3075 recN 39 5.5 TACTGTATATAAAACCAGTC
y3075 recN 61 4.5 TACTGTGTTCAAATACAGAC
y0580 uvrA -318 4.8 CACTGGATATCCATTCAGGT
y0448 rmuC -62 4.6 CTCTGGACATCCATACAGTA
Serratia proteamaculans 568
Spro_0186 uvrD -56 4.4 CTCTGTATAAATTCCCAGTG
Spro_0841 recA -100 5.8 TACTGTATGACCATACAGTA
Spro_1755 sulA -41 5.9 TACTGTATAAACATACAGTG
Spro_0962 dinB -35 5.7 GCCTGTATATTTATACAGTA
Spro_4460 lexA -47 5 ACCTGTATATACTCACAGCA
Spro_4460 lexA -26 5.2 GACTGTATAAACAAACAGGG
Spro_1683 ftsK -85 5.7 TCCTGTTTATTCATACAGTT
Spro_2124 ydjM -39 5.4 TACTGGATAAATTAACAGTT
Spro_3686 recN -68 5.5 TACTGTATATAAAACCAGTC
Spro_3686 recN -46 5 TACTGTATGAAACCACAGTT
Spro_3686 recN -28 4.5 TTATGTATTTATACACAGGA
Spro_1317 uvrB -130 5.3 AGCTGGTTTTATATCCAGTA
Spro_1895 dinI -39 6 AACTGTATAAATATCCAGTA
Spro_2777 ruvA -91 4.6 GGCTGGATATTCATCCAGCC
Spro_2803 yebG -44 6.1 TACTGTATAAAAATACAGTA
Spro_0064 tag -34 5.3 TACTGTAAATAAACACAGCA
Spro_4439 ssb -157 5.2 ACCTGAATGAATATCCAGTA
Spro_4440 uvrA -140 5.2 TACTGGATATTCATTCAGGT
Spro_0247 rmuC -86 4.8 GACTGGACATCCATACAGCA
Erwinia carotovora subsp. atroseptica SCRI1043
ECA4179 uvrD -71 4.5 ATCTGTATAAATCACCAGTG
ECA3369 recA -101 5.7 TGCTGTATGTGTATACAGTA
ECA1752 sulA -41 6.1 TACTGTATGTTCATACAGTA
ECA3468 dinB -36 5.5 ATCTGTATATTCATACAGTA
ECA0630 lexA -47 5 ACCTGTATATACTCACAGCA
ECA0630 lexA -26 5 GACTGTATAAACAACCAGGG
ECA2647 ftsK -78 5 TCCTGTGAATTTATACAGTC
ECA2409 ydjM -36 5.4 TACTGTATAAAATAACAGTT
ECA0840 recN -61 5.7 TACTGTATATAAAACCAGTT
ECA0840 recN -39 5.4 TACTGTATGTAAACACAGTC
ECA1786 dinI -38 5.9 AACTGTATAAATAAACAGTT
ECA2492 ruvA -84 4.9 TGCTGGATATTCATCCAGCC
ECA0082 tag -115 4.9 CGCTGGTTGCATATACAGCA
ECA3690 ssb -158 5.5 AACTGAATGAATATCCAGTA
ECA3689 uvrA -107 5.5 TACTGGATATTCATTCAGTT
ECA2820 uvrB -232 5.6 TgCTGTtTtTATATcCAGTA
ECA0195 rmuC -64 4.9 TTCTGGACATCCATACAGTA
Edwardsiella tarda EIB202
ETAE_0126 uvrD -65 5 TTCTGTATAAATCTCCAGTA
ETAE_2861 recA -63 5.7 TACTGTATGAGCATACAGTA
ETAE_1269 sulA -115 5.9 TACTGTATAAGCATACAGTA
ETAE_0788 dinB -42 5.6 TGCTGTATACTCATACAGTA
ETAE_0230 lexA -47 5 ACCTGTATATACTCACAGCA
ETAE_0230 lexA -26 5 AACTGTATAAACGAACAGGG
ETAE_2199 ftsK -114 5.4 TCCTGTGTATGTATACAGTT
ETAE_1569 ydjM -109 5.5 TTCTGTATATTTATACAGCA
ETAE_2737 recN -68 5.6 TACTGTATAAAAAACCAGTT
ETAE_2737 recN -46 4.6 TACTGGCATTAAACACAGTA
ETAE_2547 uvrB -106 5.2 AGCTGGGTAAATATCCAGTA
ETAE_2072 dinI -42 5.7 AGCTGTATATATTTACAGTA
ETAE_1439 ruvA -74 4.6 GGCTGGATATTCATCCAGCC
ETAE_1833 yebG -31 5.8 TACTGTATATAAAAACAGTG
ETAE_3183 ssb -155 5.3 AACTGAATGGATATCCAGTA
ETAE_3184 uvrA -92 5.3 TACTGGATATCCATTCAGTT
ETAE_0146 rmuC -63 4.5 CTCTGGACATCCATACAGTT
Proteus mirabilis HI4320
PMI3340 uvrD -47 5.1 TTCTGTATATATCCACAGTA
PMI0375 recA -102 6.1 TACTGTATGATTATACAGTA
PMI0786 sulA -39 6.3 TACTGTATATACATACAGTA
PMI0362 dinB -39 6.1 TACTGTATATTTAAACAGTA
PMI2749 lexA -47 4.9 ACCTGTATATACTCACAGTC
PMI2749 lexA -26 5.2 GACTGTATAAACAAACAGGG
PMI0697 ftsK -83 5.6 TCCTGTTTATGTATACAGTT
PMI1020 ydjM -54 5.2 CACTGTATAAATGAACAGCA
PMI1902 recN -66 5.6 TACTGTATAAAAAACCAGTT
PMI1902 recN -44 5.1 TACTGTATGTAATTACAGAT
PMI0607 uvrB -51 5.3 AGCTGGATTTTTATCCAGTA
PMI1115 ruvA -68 4.5 GGCTGGATATACGTCCAGCT
PMI2853 tag -78 4.7 ACATGTGTTTTTATACAGTA
PMI3143 null -25 5.6 AACTGTTTTTATATACAGGT
PMI2484 umuD -47 6.1 TACTGTATAAATAAACAGTA
PMI1958 dinI -45 6.1 TACTGTATTTATATACAGTT
PMI2747 ssb -188 5.3 AGCTGAATGGATATACAGTA
PMI2746 uvrA -84 5.3 TACTGTATATCCATTCAGCT
Photorhabdus luminescens subsp. laumondii TTO1
plu4636 uvrD -55 5 TTCTGTATAAAAACACAGCA
plu1249 recA -100 5.8 TGCTGTATGATTATACAGTA
plu1776 sulA -40 6 TACTGTATATTAATACAGTT
plu1239 dinB -42 4.8 TTATGTATGTTTATACAGTT
plu4374 lexA -26 5.2 GACTGTATAAACAAACAGGG
plu1601 ftsK -81 5.5 TCCTGTTTATGCATACAGTT
plu2679 ydjM -37 5 GACTGTATGGATAGACAGTT
plu3374 recN -68 5.6 TACTGTATAAAAAACCAGTT
plu3374 recN -46 4.8 TACTGTATGAAGATACAGAG
plu3374 recN -28 4.5 AGGTGTTTTTATACACAGGA
plu1491 uvrB -56 5.3 AGCTGGTTTTATATCCAGTA
plu2111 ruvA -85 4.6 GGCTGGATATGCATCCAGCT
plu0292 tag -65 5.1 ACTTGTATATCTATACAGTT
plu1815 dinI -65 5.7 TACTGTTTATATGAACAGTA
plu4349 ssb -169 5.3 GACTGATTAGATATACAGTA
plu4350 uvrA -209 5.3 TACTGTATATCTAATCAGTC
plu4414 rmuC -65 5 TTCTGGACATCTATACAGTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD