Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator MntR in Enterobacteriales

Properties
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Regulog: MntR - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Escherichia coli str. K-12 substr. MG1655
b0817 mntR -129 6.9 AGATATAGCACAGGCTATATTA
b2392 mntH -34 6.9 AAACATAGCAAAGGCTATGTTT
b1821 mntP -383 6.2 AGACATAGCTTAGGCTATATTA
b1821 mntP -423 5.3 GAATTTAGCCAAAGCTATGTTT
b0812 dps -67 5.3 ACACATAGCCGGTGCTATACTT
Salmonella typhimurium LT2
STM0835 mntR -128 6.8 AGATATAGCACAGGCTATGTTT
STM2408 mntH -34 6.9 AAACATAGCAAAGGCTATGTTT
STM2861 sitA -57 6.7 TAACATAGCAAAGGCTATATTC
STM1834 mntP -308 6.4 TAATATAGCTAAGGCTATATTT
STM1834 mntP -351 5.1 AGATATAGCCTCAACTATGTTT
Citrobacter koseri ATCC BAA-895
CKO_00404 mntH -16 6.9 AAACATAGCAAAGGCTATGTTT
CKO_04090 sitA -42 6.7 TAACATAGCAAAGGCTATATTC
CKO_00940 sitA -88 6.1 AAATATAGCCTGTGCTATGTTG
CKO_02301 mntR -129 6.9 AGATATAGCACAGGCTATATTA
CKO_01156 mntP -373 6.4 AAACATAGCTAAGGCTATATTC
CKO_01156 mntP -416 5.2 AGATATAGCCTGAACTATGTTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
KPN_02743 mntH -35 7.1 AAACATAGCAAAGGCTATATTT
KPN_03078 sitA -76 4.7 ATAAATAGCTTGTGCTATATAA
KPN_03078 sitA -57 5.7 TAACATAGCAATGGCTATAAAC
KPN_00845 mntR -163 7 AGATATAGCACAGGCTATATTT
KPN_02337 mntP -449 6 AAATATAGCCAGCGCTATATTA
KPN_02337 mntP -406 5.8 TATTATAGCCACGGCTATATTT
Enterobacter sp. 638
Ent638_2926 mntH -34 6.8 AAACATAGCAAAGGCTATATCT
Ent638_1111 sitA -75 6.2 AAATATAGCCTATGCTATATAA
Ent638_1111 sitA -56 5.3 TAAGATAGCACAGGCTAATTTT
Ent638_1304 mntR -128 6.9 AGATATAGCACAGGCTATATTG
Ent638_2390 mntP -313 5.5 ATATATAGCCATCGCTATATTC
Ent638_2390 mntP -356 6.3 AATTATAGCAGAGGCTATATTT
Erwinia amylovora ATCC 49946
EAM_1275 mntR -137 6.6 AGATATAGCACAGGCTATATCG
EAM_2087 sitA -54 4.9 TGTTATAGCAATTGCTATTTAG
EAM_2087 sitA -73 5.6 GGATATAGCCTGTGCTATATGT
EAM_2378 mntH -133 6.4 AAGTATAGCAATTGCTATATTT
EAM_3371 mntP -168 5.7 AAGTATAGCCGATGCTATAATC
Serratia proteamaculans 568
Spro_1916 mntH -70 5.5 AAGTGTAGCCGATGCTACATTG
Spro_1915 mntR -181 5.3 CAATGTAGCATCGGCTACACTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD