Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator MarR in Enterobacteriales

Properties
Regulator family: MarR
Regulation mode: repressor
Biological process: Antibiotic resistance
Effector: Salicylate; Tetracycline; Chloramphenicol
Regulog: MarR - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Escherichia coli str. K-12 substr. MG1655
b1530 marR -22 6.3 ATTACTTGCCAGGGCAACTAAT
b1530 marR -57 6.8 TATACTTGCCTGGGCAATATTA
Salmonella typhimurium LT2
STM1520 marR -22 6.8 ATTACTTGCCGGGGCAACCATT
STM1520 marR -57 7 TATACTTGCCTGGGCAATAGTA
Citrobacter koseri ATCC BAA-895
CKO_01551 marR -22 6.7 ACTACTTGCCGGGGCAACCATT
CKO_01551 marR -57 6.7 TATATTTGCCTGGGCAATAGTA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
KPN_01625 marR -22 7 ATTACTTGCCTGGGCAACCATT
KPN_01625 marR -57 6.3 TATGATTGCCTGGGCAATAGTA
Enterobacter sp. 638
Ent638_1998 marR -58 6.8 TATACTTGCCTGAGCAATAATA
Ent638_1998 marR -22 6.7 ACTACTTGCCAGGGCAACCATT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD