Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HisR in Bacillales

Properties
Regulator family: TrpR
Regulation mode: repressor
Biological process: Histidine biosynthesis
Effector: Histidine
Regulog: HisR - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus subtilis subsp. subtilis str. 168
BSU34930 hisZ -65 5.3 CATATTAGCGAACTAAAGGA
BSU32040 yuiF -39 5.7 TACATTAGCAAACTAAAGGA
Bacillus amyloliquefaciens FZB42
RBAM_032140 hisZ -61 5.3 CATATTAGCGAACTAAAGGA
RBAM_029090 yuiF -39 5.7 TACATTAGCAAACTAAAGGA
Bacillus pumilus SAFR-032
BPUM_3128 hisZ -62 5.3 CATATTAGCGAACTAAAGGA
BPUM_2865 yuiF -36 5.8 TACATTAGTAAACTAAAGGA
Bacillus licheniformis DSM 13
BLi03738 hisZ -62 5.5 CATATTAGCGAACTAAAGTA
BLi03386 yuiF -40 5.8 TACATTAGCAAACTAAAGTG
Anoxybacillus flavithermus WK1
Aflv_2537 hisZ -55 4.9 AACTTTACTTTGCTAATATA
Aflv_2537 hisZ -39 5.6 TATATTAGCGAACTAAAGTA
Aflv_1385 yuiF -34 5.2 CAATTTATCAAACTAAAGTG
Geobacillus kaustophilus HTA426
GK3077 hisZ -42 5.4 CATATTAGCAAACTAAAGCA
Bacillus halodurans C-125
BH3584 hisZ -71 4.3 TCCTTTATCTTGTTAGTATA
BH3584 hisZ -55 5.6 TATATTAGCGAACTAAAGTA
BH3359 yuiF -47 5.1 TGATTTAATAAACTAAAGCA
Bacillus clausii KSM-K16
ABC3050 hisZ -43 5.6 TGATTTAGCAAACTAAAGTA
ABC2918 yuiF -30 4.8 TGATTTAATAAGATAAAGGA
Oceanobacillus iheyensis HTE831
OB0553 hisZ -66 4.8 AACTTTACTTAGATAAAGTG
OB0879 yuiF -50 4.8 TGCTTTATCATGATGAAGTA
Paenibacillus sp. JDR-2
Pjdr2_0159 hisZ -37 5.6 CACTTTAATATACTAAAGTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD