Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator NsrR in Bacillales

Properties
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Nitrosative stress response
Effector: Nitric oxide
Regulog: NsrR - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus subtilis subsp. subtilis str. 168
BSU13040 hmp -93 6.5 TAAAGATTCATTTTAGATATATCTTTT
BSU13040 hmp -46 7.5 TAAAGATATATTTTAAATACATCTTTT
BSU03300 nasD -74 6.4 ATAACATGTATCTTAAATATTCCTTTT
Bacillus amyloliquefaciens FZB42
RBAM_028210 hmp -92 6.7 TAAAGATTCATTTTAAATATATCTTTT
RBAM_028210 hmp -45 7.3 TAAAGATATATTGAAAATACATCTTTA
RBAM_003510 nasD -73 5.8 ATAACATGCACCTTAAATATTTGTTTT
Bacillus pumilus SAFR-032
BPUM_0893 nsrR -167 7.5 AAAAGGTGTATTTTAAATACATCTTTA
BPUM_0893 nsrR -119 6.4 AAAAGCAATATTTATAATACATGTTTT
BPUM_0894 hmp -91 6.4 AAAACATGTATTATAAATATTGCTTTT
BPUM_0894 hmp -43 7.5 TAAAGATGTATTTAAAATACACCTTTT
BPUM_1811 nasD -72 6.6 AAAAGGTGTATTTTATATCTATGTTTA
Bacillus licheniformis DSM 13
BLi01005 nsrR -232 6.9 TAAAAATGTATTTGAAATACATCTTTA
BLi01005 nsrR -161 7.5 TAAAGATGTATTTTAGATACATCTTTA
BLi01005 nsrR -114 5.3 TAAAGCAATATTATCAATGAATGTTTT
BLi01006 hmp -170 5.3 AAAACATTCATTGATAATATTGCTTTA
BLi01006 hmp -123 7.5 TAAAGATGTATCTAAAATACATCTTTA
BLi01006 hmp -52 6.9 TAAAGATGTATTTCAAATACATTTTTA
BLi00484 nasD -67 6.5 TAAAGATGTAAATAGAATACTTGTTTA
Geobacillus kaustophilus HTA426
GK1738 nsrR -155 7.3 AAAACATGTATTTTTAATACATCTTTT
GK1738 nsrR -107 6 AAAAACAATATTTCAAATACATCTTTA
GK1737 hmp -91 6 TAAAGATGTATTTGAAATATTGTTTTT
GK1737 hmp -43 7.3 AAAAGATGTATTAAAAATACATGTTTT
Bacillus halodurans C-125
BH1058 hmp -95 6.2 TAAATATGTATTTTAAATATTGATTAA
BH1058 hmp -48 6.7 TAAATATGTATACAAAATACTTATTTA
Bacillus clausii KSM-K16
ABC0349 nsrR -173 6.9 AAAATAAGTATTTTATATATATATTTA
ABC0349 nsrR -126 5.8 TAAATCAATATTTAAAATGCATATTAT
ABC0350 hmp -91 5.8 ATAATATGCATTTTAAATATTGATTTA
ABC0350 hmp -44 6.9 TAAATATATATATAAAATACTTATTTT
Oceanobacillus iheyensis HTE831
OB0292 nsrR -116 7.3 AAAAGATGTATTTTCTATACATCTTTT
OB0291 hmp -43 7.3 AAAAGATGTATAGAAAATACATCTTTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD