Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CymR in Bacillales

Properties
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine; CysK, cysteine synthetase
Regulog: CymR - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus subtilis subsp. subtilis str. 168
BSU27280 yrrT -49 6.1 TAATCCATAGTATACTTATAGGAATTA
BSU00730 cysK -39 5.4 TAATACCAATACAAATAGTCGGAAATT
BSU39520 yxeK -82 5.6 TTATTCATATTAAACGACTAGGAATAT
BSU29390 ytmI -54 5.7 AAAAGCTTAGTAAACAAATAGGAATTA
BSU04520 ydbM -45 6.4 TAATACATATTAAATTTATCGGAATTA
BSU09130 yhcL -73 5.2 TAATTCGCACTTGACCCATCGGAATTA
BSU08830 ssuB -167 4.6 TAAAAAAGAGTTGACATATCGGAATAA
BSU29400 ytlI -125 5.7 TAATTCCTATTTGTTTACTAAGCTTTT
Bacillus amyloliquefaciens FZB42
RBAM_024380 yrrT -49 5.9 TAATCCATACTATACTCATAGGAATTA
RBAM_000840 cysK -39 5.8 TAATACCAATAAATTTAGTCGGAAATT
RBAM_003900 yxeK -85 6 TTATTCTTATAAAATTACTAGGAAATA
RBAM_030850 ytmI -54 5.3 CAAAGCTTAGTAAACAAATTGGAATTA
RBAM_004850 ydbM -82 6 TAATACTTATTAACTTTATCGGAATTA
RBAM_015400 cysH -299 4.7 TTATTCCTATCAAAAAACTCGGGTTGA
RBAM_030860 ytlI -100 5.3 TAATTCCAATTTGTTTACTAAGCTTTG
Bacillus pumilus SAFR-032
BPUM_2363 yrrT -51 5.4 TAAAACATACTATACGCATAGGAATAA
BPUM_0345 yxeK -84 5.5 TAAAACCGATTAATTCAATCAGAAAAA
BPUM_2341 ydbM -89 5.5 TAAATCCTATAAGTAAAGTGTGTTTTA
BPUM_2341 ydbM -61 4.9 TTATTCCGATTGGAAAAATCAGATATG
BPUM_0057 cysK -40 4.6 TtAaTaCaATaAAATTAcTcGGAgaTA
Bacillus licheniformis DSM 13
BLi02856 yrrT -54 5.8 TAAATCATACTATACTTATAGGAATTG
BLi00089 cysK -38 5.6 TAATCCCAATAAAATTACTCGGAAATT
BLi00540 ydbM -45 5.9 TAATACTTATTAAATCTATCGGAATTT
BLi00975 yhcL -77 5.1 TAATTCCTACTTGACCAATCAGGTTTG
BLi01302 cysJ -105 5.5 TAAAACCGATTTGATTTATAGGAATAG
BLi01300 cysL -242 5.5 CTATTCCTATAAATCAAATCGGTTTTA
Anoxybacillus flavithermus WK1
Aflv_0758 yrrT -36 6.4 TAATTCATACTATACTTATAGGAATTA
Aflv_0065 cysK -30 5 CAAATTCTATAAAAATACTCGGGATTA
Aflv_0316 cysH -100 5.1 AAATTCCGATAGAAAAACTAGGATTGA
Aflv_0314 sat -48 5.6 TTAATCCTAGTTGTTTTATAAGAATAA
Aflv_1597 cysJ -48 5.4 TAAAACATACTTGATTTATAGGAATAG
Aflv_1598 cysL -112 5.4 CTATTCCTATAAATCAAGTATGTTTTA
Geobacillus kaustophilus HTA426
GK2543 yrrT -51 5.9 AAAAACATACTATATTTATAGGAATTA
GK0065 cysK -38 4.7 CAAAGTCGATAAAATTAATGGGGATTA
GK1638 ytnM -80 5.2 AAATTCATAGTTGACATCTATGAATAA
Bacillus cereus ATCC 14579
BC4369 yrrT -29 5.1 TAAAACCGATAAGAAAAAGGGGAATTT
BC0075 cysK -39 5.3 TAAAACCAATAAAAATACTCGGTGTTA
BC3050 ytnM -136 5.4 TAAAACCTAGTTGATTTATACGATTAA
BC4242 yhcL -72 5.5 AATTTCATAGTTGACTTATAGGTTTTA
BC4242 yhcL -39 4.8 TATATTCTATATAACAGATTGGAATTA
BC2912 ssuB -174 5.7 TAAAACCTAGTTGACTTATCGGAAATA
BC1090 subI -158 5.4 AAATTCCAAGTTGACACATATGAATTA
Bacillus halodurans C-125
BH0088 cysK -39 5.2 GAAAACCAATAAATTTACTTGGGATTA
BH1485 BH1485 -73 5.3 TAAATCATATCAAATTACATGGAATTA
BH1489 cysC -53 5.3 TAAAACATAGTAAACAGATATGAATTT
BH0609 cysJ -87 5.7 TAAAACCAATTTGACTTATCGGAATAA
BH3125 BH3125 -142 4.8 TAAAACCCACTTGACAGATGGGGATTA
BH3125 BH3125 -50 4.6 TAAAACAGACTTTTCCGATCTGTTTTA
Bacillus clausii KSM-K16
ABC0109 cysK -42 4.9 TAAAACCAATGAAGATACTAGGGATTG
ABC2897 yhcL -78 5.2 TAATTCCCACTTGACTCATATGATTAT
ABC0612 sat -265 4.9 AAATACCGAGTTTGTTAATCAGGATAA
Oceanobacillus iheyensis HTE831
OB0084 cysK -41 6 TAAATCTTATAAAAATACTTGGAATTA
OB0293 ydbM -45 5.5 TTATACCTATTGACTTACTAGGCATTA
OB2714 yhcL -56 6.2 TAATTCGTAGTAAATTAATTGGAATTA
OB1652 cysH -98 5.4 CAATTCACATTGTATTACTATGAATTA
Paenibacillus sp. JDR-2
Pjdr2_5106 yrrT -105 5.2 TAAATCCGATTAATAAGGTTGGAAAAA
Pjdr2_0074 cysK -44 5.7 AAAAACCAACTAAATTAGTCGGAATAA
Pjdr2_5233 ytmI -55 6.1 TAATTCTTAGTAAGTTTATAGGAATTA
Pjdr2_6037 yhcL -148 5.1 AATTCCCCATAGAAATAGTCGGATTTA
Pjdr2_6037 yhcL -41 5 TAATTCCAATCAAACAACTTGGATTAG
Pjdr2_5647 cysH -45 5.2 AATAGCATATGAATTTACTTGGAATTA
Pjdr2_6187 ssuB -53 4.9 TAATTCCAAGTAAATCGGTGTGAAAAA
Pjdr2_0756 ssuB -70 5.3 TAATTCCAACTATTCCAATAAGGAAAA
Pjdr2_0760 ssuA -50 5.2 TAAATCCGATTAAACAAATAAGTAAAG
Pjdr2_4823 subI -96 4.7 CATAACCAACTAAACAGGTAGGAATAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD