Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AcrR in Enterobacteriales

Properties
Regulator family: TetR
Regulation mode: repressor
Biological process: Multidrug resistance
Effector: Rhodamine 6G; Ethidium bromide; Proflavin
Regulog: AcrR - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Escherichia coli str. K-12 substr. MG1655
b0463 acrA -113 7.9 TACATACATTTGTGAATGTATGTA
b0464 acrR -52 7.3 TACATACATTCACAAATGTATGTA
Salmonella typhimurium LT2
STM0476 acrA -113 7.8 TACATACATTTATGGATGTATGTA
STM0477 acrR -52 6.9 TACATACATCCATAAATGTATGTA
Citrobacter koseri ATCC BAA-895
CKO_02688 acrA -113 7.8 TACATACATTTGTGGATGTATGTA
CKO_02687 acrR -52 6.9 TACATACATCCACAAATGTATGTA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
KPN_00444 acrA -114 7.9 TACATACATTTGTGAATGTATGTA
KPN_00445 acrR -52 7.3 TACATACATTCACAAATGTATGTA
Enterobacter sp. 638
Ent638_0943 acrA -114 7.9 TACATACATTTATGAATGTATGTA
Ent638_0944 acrR -52 7.4 TACATACATTCATAAATGTATGTA
Erwinia amylovora ATCC 49946
EAM_1017 acrA -105 7.8 TACATACATTTGCGAATGTATGTA
EAM_1018 acrR -52 7.3 TACATACATTCGCAAATGTATGTA
Yersinia pestis KIM
y1050 acrA -116 7.8 TACATACATTCACGAATGTATGTA
y1051 acrR -52 7.9 TACATACATTCGTGAATGTATGTA
Serratia proteamaculans 568
Spro_1127 acrA -114 7.7 TACATACATTCGCGTATGTATGTA
Spro_1128 acrR -52 7.3 TACATACATACGCGAATGTATGTA
Erwinia carotovora subsp. atroseptica SCRI1043
ECA1170 acrA -114 7.6 TACATACATTCAAGTATGTATGTA
ECA1171 acrR -75 7 TACATACATACTTGAATGTATGTA
Edwardsiella tarda EIB202
ETAE_1011 acrA -113 7.4 TACATGCATTGATGAATGTATGTA
ETAE_1012 acrR -52 6.9 TACATACATTCATCAATGCATGTA
Proteus mirabilis HI4320
PMI0132 acrA -97 7.6 TACATACATTCATGTATGTTTGTA
PMI0133 acrR -52 6.9 TACAAACATACATGAATGTATGTA
Photorhabdus luminescens subsp. laumondii TTO1
plu3851 acrA -101 7.6 TACATACATTCACGTATGTTTGTA
plu3850 acrR -52 6.9 TACAAACATACGTGAATGTATGTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD