Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GntR in Enterobacteriales  

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Regulog: GntR - Enterobacteriales  
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Escherichia coli str. K-12 substr. MG1655
b4267 idnD -146 3.8 TAtTtcTACtGaTAAgAaTT
b3415 gntT -178 5.9 AGATGTTACCCGTATCATTC
b3415 gntT -37 4.9 TGACGTTACCCATAACAAAT
b1851 edd -212 6.3 TTATTTTACCGGTAACATGA
b3437 gntK -48 5.8 AACAGTTACCCGTAACATTT
b3437 gntK -61 6.4 CAATGTTACCGATAACAGTT
b4267 idnD -116 3.8 TcAcGTTAtgcGTAACATag
b4268 idnK -119 5 CTATGTTACGCATAACGTGA
Salmonella typhimurium LT2
STM1885 edd -212 6.1 GTATTTTACCGGTAACATGA
STM3542 gntK -48 5.1 AACAGTTACCCGTAACAAAT
STM4484 idnD -116 4.3 TcAcGTTAtgcGTAACATTg
STM3542 gntK -61 6.4 CAATGTTACCGATAACAGTT
STM3512 gntT -178 6 ATATGTTACCCGTATCATTC
STM3512 gntT -37 4.7 TGACGTTACCCATAACAAAG
STM4485 idnK -119 5.1 CAATGTTACGCATAACGTGA
Citrobacter koseri ATCC BAA-895
CKO_04836 gntT -178 6 ATATGTTACCCGTATCATTC
CKO_04836 gntT -37 4.9 CGACGTTACCCATAACAAAT
CKO_04856 gntK -101 6.4 CAATGTTACCGATAACAGTT
CKO_04856 gntK -88 5.6 AACAGTTACCCGTAACAATT
CKO_01115 edd -211 6.3 TTATTTTACCGGTAACATGA
CKO_02793 idnO -39 4.8 TACAGTTACGCGTAACAGCT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
KPN_03801 gntK -58 6.4 CAATGTTACCGATAACAGTT
KPN_03801 gntK -45 5.6 AACAGTTACCCGTAACAATT
KPN_02366 edd -211 6.3 TTATTTTACCGGTAACATGA
KPN_02366 edd -2 5.4 CAATGTTACGGGTAACAAAT
KPN_03785 gntT -180 5.5 ACATGTTACCCGTATCATCC
KPN_03785 gntT -36 4.9 TGACGTTACCCATAACAAAT
Enterobacter sp. 638
Ent638_3828 gntT -178 5.9 AGATGTTACCCGTATCATTC
Ent638_3828 gntT -37 4.9 TGACGTTACCCATAACAAAT
Ent638_3845 gntK -49 5.8 CAATGTTACCGATAACTGTT
Ent638_3845 gntK -36 6 AACTGTTACCCGTAACAATT
Ent638_2420 edd -210 6.3 TTATTTTACCGGTAACATGA
Erwinia amylovora ATCC 49946
EAM_3275 gntK -59 5.9 CAATGTTACCGATAACAACG
EAM_0336 gadA -133 5.8 TATTGTTACCGGTAACAGTC
Yersinia pestis KIM
y1651 sdxX -237 5.7 TCACGTTACCGGTAACATGT
y3875 gntT -159 6 CCATGTTACCGGTATCATGA
y3875 gntT -145 5.1 TCATGATACCGGTAACAAAT
y3876 gntK -91 5.6 ATTTGTTACCGGTATCATGA
y3876 gntK -77 5.5 TCATGATACCGGTAACATGG
Serratia proteamaculans 568
Spro_3288 idnO -120 4.2 TcAcGTTAaaGGTAACAgcT
Spro_3289 idnR -169 4.4 AGCTGTTACCTTTAACGTGA
Spro_4497 gntK -73 6.4 CAATGTTACCGATAACATGT
Spro_4497 gntK -59 5.5 ACATGTTACCGGTAACAAAC
Spro_4651 gntT -185 5.3 GGTTGTTACCGGTATCATGA
Spro_4651 gntT -171 5.4 TCATGATACCGGTAACAATG
Spro_2136 gadA -131 5.9 ATAAGTTACCGGTAACATTG
Erwinia carotovora subsp. atroseptica SCRI1043
ECA1836 edd -359 5.9 CATTGTTACCGGTATCATTT
ECA1839 gntK -91 5.4 ACTTGTTACCGGTATCATGA
ECA1839 gntK -77 5.1 TCATGATACCGGTAACGTGA
ECA4159 gntK -77 5.3 ATATGATACGGGTAACATGT
ECA1840 gntT -239 5.5 TCACGTTACCGGTATCATGA
ECA1840 gntT -225 5.6 TCATGATACCGGTAACAAGT
ECA4158 gntU -100 5.5 ACATGTTACCCGTATCATAT
Edwardsiella tarda EIB202
ETAE_0135 gntK -58 5.4 AACAGTTACCAGTAACATTG
ETAE_0135 gntK -71 6 GAATGTTACCCATAACAGTT
Proteus mirabilis HI4320
PMI2673 gntK -67 6.4 TAATGTTACCCGTAACAGTT
PMI2673 gntK -54 5.3 AACAGTTACGGGTAACATTA
PMI2760 edd -111 5.1 GCTTGTTACCCGTAACAATG
PMI2760 edd -96 6.4 CAATGTTACCGGTAACAAGT
Photorhabdus luminescens subsp. laumondii TTO1
plu0497 gntK -52 5.9 AACAGTTACCGGTAACATTT
plu0497 gntK -65 6.4 TAATGTTACCGATAACAGTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD