Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator NrtR in Cyanobacteria

Properties
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Cyanobacteria
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Synechocystis sp. PCC 6803
slr1691 nadE -34 6 TTAAAGTAATAATTACCATAA
sll0622 nadA -43 6.1 TTATGGTAGTTTTAACTATAA
slr0787 nadM -69 6 TTTTGGTGAAATCTACTATAA
Cyanothece sp. ATCC 51142
cce_2759 pncB -49 5.9 TTTTGGTAAAAGTTACTATAA
cce_3716 nadA -24 5.8 TTTTGGTAAGATCAACTATAA
Cyanothece sp. PCC 8801
PCC8801_0271 pncB -74 6 TTTTGGTAAAAACTACTATAA
PCC8801_0787 nadA -44 6.1 TTATGGTAAAAACAACTATAA
Cyanothece sp. PCC 7425
Cyan7425_2236 pncB -50 6.1 TTATGGTAGAAACTACTATAA
Cyan7425_4975 nadA -53 5.7 TTTTGGTAAATTCGACTATAA
Microcystis aeruginosa NIES-843
MAE_34940 nadD -94 5.9 TTTTGGTAAAATCAACTATAA
MAE_32960 nadA -29 5.8 ATTTGGTAAAAATAACCATAA
Nostoc sp. PCC 7120
alr2482 pncB -53 6.4 TTATGGTAAATTCTACCATAA
all4673 nadA -64 6 TTTTGGTAAAAACTACTATAA
Trichodesmium erythraeum IMS101
Tery_0318 pncB -173 5.9 ATATAGTAAGAATAACTATAA
Tery_2446 nadA -85 4.6 TTATAGTATAATTCATCAAAC
Thermosynechococcus elongatus BP-1
tlr1177 pncB -48 6.3 TTATGGTGAAACTCACTATAA
null nadA -67 5.8 TTTTGGTAAAAGTCACTATAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD