Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator LacI in Enterobacteriales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Lactose utilization
Effector: Allolactose
Regulog: LacI - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Escherichia coli str. K-12 substr. MG1655
b0344 lacZ -38 7.4 AATTGTGAGCGGATAACAATT
Citrobacter koseri ATCC BAA-895
CKO_02825 lacZ -38 7 AATTGTGAGCGAATAACAAAC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
KPN_pKPN3p05871 lacZ -37 7.2 AAATGTGAGCGGATAACAATT
Enterobacter sp. 638
Ent638_0928 lacZ -29 6.3 AATTGTGAGCGCTTCGCAAAG
Erwinia carotovora subsp. atroseptica SCRI1043
ECA1490 lacZ -73 7.4 AATTGTGAGCGGATAACAATT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD