Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IclR in Enterobacteriales

Properties
Regulator family: IclR
Regulation mode: repressor
Biological process: Glyoxylate bypass
Effector: Pyruvate; Glyoxylate
Regulog: IclR - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Escherichia coli str. K-12 substr. MG1655
b4014 aceB -125 8.3 AAAATGGAAATTGTTTTTGATTTT
Salmonella typhimurium LT2
STM4183 aceB -125 8.3 AAAATGGAAATTGTTTTTGATTTT
Citrobacter koseri ATCC BAA-895
CKO_03906 aceB -125 8.3 AAAATGGAAATTGTTTTTGATTTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
KPN_04395 aceB -117 8.3 AAAATGGAAATTGTTTTTGATTTT
Enterobacter sp. 638
Ent638_0218 aceB -127 8.3 AAAATGGAAATTGTTTTTGATTTT
Yersinia pestis KIM
y0015 aceB -147 8.2 AAAATGGAAATCGTTTTTGATTTT
Serratia proteamaculans 568
Spro_4503 aceB -172 8.1 AAAATGGAAATGGTTTTTGATTTT
Erwinia carotovora subsp. atroseptica SCRI1043
ECA3991 aceB -132 8.3 AAAATGGAAATTGTTTTTGATTTT
Proteus mirabilis HI4320
PMI2764 aceB -80 7.6 AAAATGGAATTCATTTTTGATTTT
Photorhabdus luminescens subsp. laumondii TTO1
plu4396 aceB -77 7.9 AAAATGGAAATCGTTTTTGATTTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD